Hi Olivier,
wait one second, we still need to merge the 4FS branch into 3.0.4…
I will update everybody once this is done
Cheers,

marco



> On 24 Mar 2021, at 11:13, Olivier Mattelaer <email address hidden> wrote:
> 
> Olivier Mattelaer has proposed merging lp:~maddevelopers/mg5amcnlo/3.0.4 into lp:mg5amcnlo/3.0.
> 
> Commit message:
> First non beta release
> 
> Requested reviews:
>  MadTeam (madteam)
> 
> For more details, see:
> https://code.launchpad.net/~maddevelopers/mg5amcnlo/3.0.4/+merge/400095
> 
> Target time for the release: Friday.
> Please perform all the checks that you want on this version.
> -- 
> The attached diff has been truncated due to its size.
> Your team MadDevelopers is subscribed to branch lp:~maddevelopers/mg5amcnlo/3.0.4.
> === modified file 'MadSpin/decay.py'
> --- MadSpin/decay.py	2020-06-21 21:31:33 +0000
> +++ MadSpin/decay.py	2021-03-24 10:12:56 +0000
> @@ -1,7 +1,12 @@
> #!/usr/bin/env python
> 
> from __future__ import division
> +from __future__ import absolute_import
> +from __future__ import print_function
> from madgraph.interface import reweight_interface
> +from six.moves import map
> +from six.moves import range
> +from six.moves import zip
> 
> ################################################################################
> #
> @@ -94,7 +99,7 @@
> 
>         p=[]
>         string=""
> -        for id in xrange(len(self.particle)):
> +        for id in range(len(self.particle)):
>             particle = self.particle[map_event[id] + 1]
>             if particle["istup"] < 2:
>                 mom = particle["momentum"]
> @@ -115,28 +120,26 @@
>                 pattern = re.compile(r'''<\s*wgt id=[\'\"](?P<id>[^\'\"]+)[\'\"]\s*>\s*(?P<val>[\ded+-.]*)\s*</wgt>''')
>                 data = pattern.findall(self.rwgt)
>                 if len(data)==0:
> -                    print self.rwgt
> +                    print(self.rwgt)
>                 try:
>                     text = ''.join('   <wgt id=\'%s\'> %+15.7e </wgt>\n' % (pid, float(value) * factor)
>                                      for (pid,value) in data) 
> -                except ValueError, error:
> -                    raise Exception, 'Event File has unvalid weight. %s' % error
> +                except ValueError as error:
> +                    raise Exception('Event File has unvalid weight. %s' % error)
>                 self.rwgt = self.rwgt[:start] + '<rwgt>\n'+ text + self.rwgt[stop:]          
> 
>     def string_event_compact(self):
>         """ return a string with the momenta of the event written 
>                 in an easy readable way
>         """
> -        line=""
> +        line=[]
>         for part in range(1,len(self.particle)+1):
> -            line+=str(self.particle[part]["pid"])+" "
> -            line+=str(self.particle[part]["momentum"].px)+" "
> -            line+=str(self.particle[part]["momentum"].py)+" "
> -            line+=str(self.particle[part]["momentum"].pz)+" "
> -            line+=str(self.particle[part]["momentum"].E)+"    " 
> -            line+=str(self.particle[part]["momentum"].m)+"    " 
> -            line+="\n"
> -        return line
> +            pid = self.particle[part]["pid"]
> +            m = self.particle[part]["momentum"]
> +            line.append("%i %s %.7g %.7g %.7g %.7g" % 
> +                        (pid, m.px, m.py, m.pz, m.E, m.m))
> +        line.append('')
> +        return "\n".join(line)
> 
>     def get_tag(self):
> 
> @@ -170,7 +173,7 @@
>         (self.nexternal,self.ievent,self.wgt,self.scale,self.aqed,self.aqcd)
>         line+=line1+"\n"
>         scales= []
> -        for item in range(1,len(self.event2mg.keys())+1):
> +        for item in range(1,len(list(self.event2mg.keys()))+1):
>             part=self.event2mg[item]
>             if part>0:
>                 particle_line=self.get_particle_line(self.particle[part])
> @@ -556,7 +559,7 @@
>                     # I don't expect this to be inefficient, since there is a BW cut                                    
> 
>             if tree["nbody"] > 2:
> -                raise Exception, 'Phase Space generator not yet ready for 3 body decay'
> +                raise Exception('Phase Space generator not yet ready for 3 body decay')
> 
>             if ran==1:
>                 decay_mom=generate_2body_decay(index2mom[res]["momentum"],mA, all_mass[0],all_mass[1])
> @@ -874,7 +877,7 @@
>             line+=str(d1)+" + "
>             line+=str(d2)+" ,    type="
>             line+=branch["type"]
> -            print line
> +            print(line)
> 
> class AllMatrixElement(dict):
>     """Object containing all the production topologies required for event to decay.
> @@ -921,7 +924,7 @@
>                 logger.warning("No Branching ratio applied for %s. Please check if this is expected" % init[0])
>                 br *= self.get_br(decay)
>             else:
> -                raise MadGraph5Error,"No valid decay for %s. No 2 body decay for that particle. (three body are not supported by MadSpin)" % init[0]
> +                raise MadGraph5Error("No valid decay for %s. No 2 body decay for that particle. (three body are not supported by MadSpin)" % init[0])
> 
> 
> 
> @@ -1127,7 +1130,7 @@
> 
>                     # Reorganize s-channel vertices to get a list of all
>                     # subprocesses for each vertex
> -                    schannels = zip(*[s for s,t in stchannels])
> +                    schannels = list(zip(*[s for s,t in stchannels]))
>             else:
>                     schannels = []
> 
> @@ -1168,7 +1171,7 @@
>             if decay['decay_tag']==decay_tag: return decay
> 
>         msg = 'Unable to retrieve decay from decay_tag\n%s\n%s' %(production_tag, decay_tag)
> -        raise Exception, msg
> +        raise Exception(msg)
> 
>     def get_random_decay(self, production_tag,first=[]):
>         """select randomly a decay channel"""
> @@ -1384,32 +1387,32 @@
>                     initial=item
>                     if item not in [ particle['name'] for particle in base_model['particles'] ] \
>                         and item not in [ particle['antiname'] for particle in base_model['particles'] ]:
> -                        raise Exception, "No particle "+item+ " in the model "+model
> +                        raise Exception("No particle "+item+ " in the model "+model)
>                     continue
>                 elif item=='>': continue       # case 2: we have the > symbole
>                 elif item not in ponctuation : # case 3: we have a particle originating from a branching
>                     final.append(item)
>                     if next_symbol=='' or next_symbol in ponctuation:
>                         #end of a splitting, verify that it exists
> -                        if initial not in self.br.keys():
> +                        if initial not in list(self.br.keys()):
>                             logger.debug('Branching fractions of particle '+initial+' are unknown')
>                             return 0
>                         if len(final)>2:
> -                            raise Exception, 'splittings different from A > B +C are currently not implemented '
> +                            raise Exception('splittings different from A > B +C are currently not implemented ')
> 
> -                        if final[0] in multiparticles.keys():
> +                        if final[0] in list(multiparticles.keys()):
>                             set_B=[pid2label[pid] for pid in multiparticles[final[0]]]
>                         else:
>                             if final[0] not in [ particle['name'] for particle in base_model['particles'] ] \
>                                and final[0] not in [ particle['antiname'] for particle in base_model['particles'] ]:
> -                                raise Exception, "No particle "+item+ " in the model "
> +                                raise Exception("No particle "+item+ " in the model ")
>                             set_B=[final[0]]
> -                        if final[1] in multiparticles.keys():
> +                        if final[1] in list(multiparticles.keys()):
>                             set_C=[pid2label[pid] for pid in multiparticles[final[1]]]
>                         else:
>                             if final[1] not in [ particle['name'] for particle in base_model['particles'] ] \
>                                and final[1] not in [ particle['antiname'] for particle in base_model['particles'] ]:
> -                                raise Exception, "No particle "+item+ " in the model "+model
> +                                raise Exception("No particle "+item+ " in the model "+model)
>                             set_C=[final[1]]
> 
>                         splittings={}
> @@ -1538,7 +1541,7 @@
>         ff.close()
> 
>         lhapdf = False
> -        if os.environ.has_key('lhapdf'):
> +        if 'lhapdf' in os.environ:
>             lhapdf = os.environ['lhapdf']
>             del os.environ['lhapdf']
> 
> @@ -1566,7 +1569,7 @@
> 
>         label2pid = self.label2pid
>         pid2label = self.label2pid
> -        for res in self.br.keys():
> +        for res in list(self.br.keys()):
>             particle=self.model.get_particle(label2pid[res])
>             if particle['self_antipart']: 
>                 continue
> @@ -1588,7 +1591,7 @@
>                 self.br[anti_res][chan]['daughters']=[]
>                 self.br[anti_res][chan]['daughters'].append(d1bar)
>                 self.br[anti_res][chan]['daughters'].append(d2bar)
> -                if decay.has_key('width'):
> +                if 'width' in decay:
>                     self.br[anti_res][chan]['width']=decay['width']                  
> 
>     def launch_width_evaluation(self,resonances, mgcmd):
> @@ -1847,7 +1850,7 @@
>             if line =="": break
>             list_line=line.split()
>             if len(list_line)>2:
> -                if list_line[0]=="DECAY" and int(list_line[1]) in pid2widths.keys():
> +                if list_line[0]=="DECAY" and int(list_line[1]) in list(pid2widths.keys()):
>                     list_line[2]=str(pid2widths[int(list_line[1])]) 
>                     line=""
>                     for item in list_line:
> @@ -2049,7 +2052,7 @@
>         else:
>             try:
>                 self.all_ME, self.all_decay,self.width_estimator = save_load_object.load_from_file(pjoin(self.path_me,"production_me", "all_ME.pkl"))
> -            except Exception,error:
> +            except Exception as error:
>                 logger.debug(str(error))
>                 self.generate_all_matrix_element()
>                 self.save_to_file(pickle_info,
> @@ -2310,7 +2313,7 @@
>     Please relaunch MS with more events/PS point by event in the
>     computation of the maximum_weight.
>                     """ % (report['over_weight'], event_nb, 100 * report['over_weight']/event_nb )  
> -                    raise MadSpinError, error
> +                    raise MadSpinError(error)
> 
>                     error = True
>                 elif report['%s_f' % (decay['decay_tag'],)] > max(0.01*report[decay['decay_tag']],3):
> @@ -2321,7 +2324,7 @@
>                             report['%s' % (decay['decay_tag'],)],\
>                             100 * report['%s_f' % (decay['decay_tag'],)] / report[ decay['decay_tag']] ,\
>                             decay['decay_tag'])  
> -                    raise MadSpinError, error
> +                    raise MadSpinError(error)
> 
> 
>             decayed_event.change_wgt(factor= self.branching_ratio) 
> @@ -2491,7 +2494,6 @@
>             return decay_mapping
> 
>         BW_cut = self.options['BW_cut']       
> -        
>         #class the decay by class (nbody/pid)
>         nbody_to_decay = collections.defaultdict(list)
>         for decay in self.all_decay.values():
> @@ -2525,7 +2527,6 @@
>                     '\n'.join(str(tree[i]['momentum']) for i in range(1, len(tree))
>                                                                   if i in tree))
> 
> -                
>                 values = {}                
>                 for i in range(len(decays)):
>                     if any([valid[(i,j)] for j in range(len(decays)) if i !=j]):
> @@ -2559,7 +2560,6 @@
>                         comment+=  "%4e " % valid[(i,j)]
>                     comment+= "|"+ os.path.basename(decays[i]['path'])                     
>                     logger.debug(comment)
> -            
>             # store the result in the relation object. (using tag as key)
>             for i in range(len(decays)):
>                 tag_i = decays[i]['tag'][2:]
> @@ -2654,7 +2654,7 @@
>             pass
>         try:
>             shutil.rmtree(pjoin(path_me,'production_me'))
> -        except Exception, error:
> +        except Exception as error:
>             pass
>         path_me = self.path_me        
> 
> @@ -2683,7 +2683,7 @@
>                 if name == 'all':
>                     continue
>                 #self.banner.get('proc_card').get('multiparticles'):
> -                mgcmd.do_define("%s = %s" % (name, ' '.join(`i` for i in pdgs)))
> +                mgcmd.do_define("%s = %s" % (name, ' '.join(repr(i) for i in pdgs)))
> 
> 
>         mgcmd.exec_cmd("set group_subprocesses False")
> @@ -2701,7 +2701,7 @@
> 
>         mgcmd.exec_cmd(commandline, precmd=True)
>         commandline = 'output standalone_msP %s %s' % \
> -        (pjoin(path_me,'production_me'), ' '.join(self.list_branches.keys()))        
> +        (pjoin(path_me,'production_me'), ' '.join(list(self.list_branches.keys())))        
>         mgcmd.exec_cmd(commandline, precmd=True)        
>         logger.info('Done %.4g' % (time.time()-start))
> 
> @@ -2722,19 +2722,19 @@
>                 if self.all_ME.has_particles_ambiguity:
>                     final_states.add(self.pid2label[-1*self.pid2label[label]])
>                 final_states.add(label)
> -        for key in self.list_branches.keys():
> +        for key in list(self.list_branches.keys()):
>             if key not in final_states and key not in self.mgcmd._multiparticles:
>                 if (len(self.list_branches)>1):
>                     del self.list_branches[key]
>                 elif not self.options["onlyhelicity"]:
> -                    raise Exception, " No decay define for process."
> +                    raise Exception(" No decay define for process.")
>                     logger.info('keeping dummy decay for passthrough mode')
> 
>         # 4. compute the full matrix element -----------------------------------
>         if not self.options["onlyhelicity"]:
>             logger.info('generating the full matrix element squared (with decay)')
>             start = time.time()
> -            to_decay = self.mscmd.list_branches.keys()
> +            to_decay = list(self.mscmd.list_branches.keys())
>             decay_text = []
>             for decays in self.mscmd.list_branches.values():
>                 for decay in  decays:
> @@ -2757,13 +2757,13 @@
>             # remove decay with 0 branching ratio.
>             mgcmd.remove_pointless_decay(self.banner.param_card)
>             commandline = 'output standalone_msF %s %s' % (pjoin(path_me,'full_me'),
> -                                                          ' '.join(self.list_branches.keys()))
> +                                                          ' '.join(list(self.list_branches.keys())))
>             mgcmd.exec_cmd(commandline, precmd=True)
>             logger.info('Done %.4g' % (time.time()-start))
>         elif self.options["onlyhelicity"]:
>             logger.info("Helicity Matrix-Element")      
>             commandline = 'output standalone_msF %s %s' % \
> -            (pjoin(path_me,'full_me'), ' '.join(self.list_branches.keys()))        
> +            (pjoin(path_me,'full_me'), ' '.join(list(self.list_branches.keys())))        
>             mgcmd.exec_cmd(commandline, precmd=True)        
>             logger.info('Done %.4g' % (time.time()-start))                    
> 
> @@ -2875,7 +2875,7 @@
>                 try:
>                     proc_nb = int(proc_nb)
>                 except ValueError:
> -                    raise MadSpinError, 'MadSpin didn\'t allow order restriction after the @ comment: \"%s\" not valid' % proc_nb
> +                    raise MadSpinError('MadSpin didn\'t allow order restriction after the @ comment: \"%s\" not valid' % proc_nb)
>                 proc_nb = '@%i' % proc_nb 
>             else:
>                 baseproc = new_proc
> @@ -2896,7 +2896,7 @@
>             else:
>                 part = baseproc.split(',')
>                 if any('(' in p for p in part):
> -                    raise Exception, 'too much decay at MG level. this can not be done for the moment)'            
> +                    raise Exception('too much decay at MG level. this can not be done for the moment)')            
>                 else:
>                     decay_part = []
>                     for p in part[1:]:
> @@ -2912,7 +2912,7 @@
>         # Compute the width branching ratio. Doing this at this point allows
>         #to remove potential pointless decay in the diagram generation.
>         resonances = decay_misc.get_all_resonances(self.banner, 
> -                         self.mgcmd, self.mscmd.list_branches.keys())
> +                         self.mgcmd, list(self.mscmd.list_branches.keys()))
> 
>         logger.debug('List of resonances:%s' % resonances)
>         path_me = os.path.realpath(self.path_me) 
> @@ -3030,9 +3030,9 @@
> 
>                 if __debug__:
>                     if(os.path.getsize(pjoin(path_me, mode,'SubProcesses', 'parameters.inc'))<10):
> -                        print pjoin(path_me, mode,'SubProcesses', 'parameters.inc')
> -                        raise Exception, "Parameters of the model were not written correctly ! %s " %\
> -                            os.path.getsize(pjoin(path_me, mode,'SubProcesses', 'parameters.inc'))
> +                        print(pjoin(path_me, mode,'SubProcesses', 'parameters.inc'))
> +                        raise Exception("Parameters of the model were not written correctly ! %s " %\
> +                            os.path.getsize(pjoin(path_me, mode,'SubProcesses', 'parameters.inc')))
> 
> 
>     def extract_resonances_mass_width(self, resonances):
> @@ -3050,7 +3050,7 @@
>                 part=abs(self.pid2label[particle_label])
>                 #mass = self.banner.get('param_card','mass', abs(part))
>                 width = self.banner.get('param_card','decay', abs(part))
> -            except ValueError, error:
> +            except ValueError as error:
>                 continue
>             else:
>                 if (width.value > 0.001):  
> @@ -3153,7 +3153,6 @@
>                     continue # No decay for this process
>                 atleastonedecay = True
>                 weight = self.get_max_weight_from_fortran(decay['path'], event_map,numberps,self.options['BW_cut'])
> -                
>                     #weight=mg5_me_full*BW_weight_prod*BW_weight_decay/mg5_me_prod
>                 if tag in max_decay:
>                     max_decay[tag] = max([max_decay[tag], weight])
> @@ -3291,10 +3290,12 @@
>                                path, std_in)
> 
>         return max_weight
> -        
> +    
> +    nb_load = 0
>     def loadfortran(self, mode, path, stdin_text, first=True):
>         """ call the fortran executable """
> 
> +        self.nb_load +=1
>         tmpdir = ''
>         if ('full',path) in self.calculator:
>             external = self.calculator[('full',path)]
> @@ -3304,17 +3305,32 @@
>             tmpdir = path
> 
>             executable_prod="./check"
> +            my_env = os.environ.copy()
> +            my_env["GFORTRAN_UNBUFFERED_ALL"] = "y"
>             external = Popen(executable_prod, stdout=PIPE, stdin=PIPE, 
> -                                                      stderr=STDOUT, cwd=tmpdir)
> +                                          stderr=STDOUT, cwd=tmpdir, env=my_env)
>             self.calculator[('full',path,)] = external 
>             self.calculator_nbcall[('full',path)] = 1 
> -
> +            
>         try:
> -            external.stdin.write(stdin_text)
> -        except IOError:
> +            external.stdin.write(stdin_text.encode())
> +            external.stdin.flush()
> +        except IOError as error:
>             if not first:
>                 raise
>             try:
> +                external.stdin.close()
> +            except Exception as  error:
> +                misc.sprint(error)
> +            try:
> +                external.stdout.close()
> +            except Exception as error:
> +                misc.sprint(error)
> +            try:
> +                external.stderr.close()
> +            except Exception as error:
> +                misc.sprint(error)
> +            try:
>                 external.terminate()
>             except:
>                 pass
> @@ -3346,7 +3362,7 @@
> 
>         if len(self.calculator) > self.options['max_running_process']:
>             logger.debug('more than %s calculators. Perform cleaning' % self.options['max_running_process'])
> -            nb_calls = self.calculator_nbcall.values()
> +            nb_calls = list(self.calculator_nbcall.values())
>             nb_calls.sort()
>             cut = max([nb_calls[len(nb_calls)//2], 0.001 * nb_calls[-1]])
>             for key, external in list(self.calculator.items()):
> @@ -3355,8 +3371,8 @@
>                     if key[0]=='full':
>                         path=key[1]
>                         end_signal="5 0 0 0 0\n"  # before closing, write down the seed 
> -                        external.stdin.write(end_signal)
> -                        ranmar_state=external.stdout.readline()
> +                        external.stdin.write(end_signal.encode())
> +                        ranmar_state=external.stdout.readline().decode()
>                         ranmar_file=pjoin(path,'ranmar_state.dat')
>                         ranmar=open(ranmar_file, 'w')
>                         ranmar.write(ranmar_state)
> @@ -3375,7 +3391,7 @@
>         """routine to return the matrix element"""
> 
>         if mode != "decay":
> -            raise Exception, "This function is only secure in mode decay."
> +            raise Exception("This function is only secure in mode decay.")
> 
>         tmpdir = ''
>         if (mode, production) in self.calculator:
> @@ -3390,30 +3406,40 @@
>                 tmpdir = pjoin(self.path_me,'%s_me' % mode, 'SubProcesses',
>                            production)
>             executable_prod="./check"
> -            external = Popen(executable_prod, stdout=PIPE, stdin=PIPE, 
> -                                                      stderr=STDOUT, cwd=tmpdir)
> +            my_env = os.environ.copy()
> +            my_env["GFORTRAN_UNBUFFERED_ALL"] = "y"
> +            external = Popen(executable_prod, stdout=PIPE, stdin=PIPE,
> +                                                      stderr=STDOUT, cwd=tmpdir,
> +                                                      env=my_env,
> +                                                      bufsize=0)
> +            assert (mode, production) not in self.calculator
>             self.calculator[(mode, production)] = external 
>             self.calculator_nbcall[(mode, production)] = 1       
> 
> -        external.stdin.write(stdin_text)
> +
> +        external.stdin.write(stdin_text.encode())
>         if mode == 'prod':
> -            info = int(external.stdout.readline())
> +            info = int(external.stdout.readline().decode())
>             nb_output = abs(info)+1
>         else:
>             info = 1
>             nb_output = 1
> -         
> -        prod_values = ' '.join([external.stdout.readline() for i in range(nb_output)])
> +        std = []
> +        for i in range(nb_output):
> +            external.stdout.flush()
> +            line = external.stdout.readline().decode()
> +            std.append(line)
> +        prod_values = ' '.join(std)
> +        #prod_values = ' '.join([external.stdout.readline().decode() for i in range(nb_output)])
>         if info < 0:
> -            print 'ZERO DETECTED'
> -            print prod_values
> -            print stdin_text
> +            print('ZERO DETECTED')
> +            print(prod_values)
> +            print(stdin_text)
>             os.system('lsof -p %s' % external.pid)
>             return ' '.join(prod_values.split()[-1*(nb_output-1):])
> -        
>         if len(self.calculator) > self.options['max_running_process']:
>             logger.debug('more than 100 calculator. Perform cleaning')
> -            nb_calls = self.calculator_nbcall.values()
> +            nb_calls = list(self.calculator_nbcall.values())
>             nb_calls.sort()
>             cut = max([nb_calls[len(nb_calls)//2], 0.001 * nb_calls[-1]])
>             for key, external in list(self.calculator.items()):
> @@ -3426,7 +3452,6 @@
>                     del self.calculator_nbcall[key]
>                 else:
>                     self.calculator_nbcall[key] = self.calculator_nbcall[key] //10
> -        
>         if mode == 'prod':
>             return prod_values
>         else:
> @@ -3457,7 +3482,7 @@
>                 #print part
>                 decay_struct[part]['mg_tree']=[]
> 
> -                nb_res=len(decay_struct[part]["tree"].keys())
> +                nb_res=len(list(decay_struct[part]["tree"].keys()))
>                 for res in range(-1,-nb_res-1,-1):
>                     label=abs(decay_struct[part]["tree"][res]['label'])
>                     mass=self.pid2massvar[label]
> @@ -3533,7 +3558,7 @@
>                 else:
>                     # now we need to write the decay products in the event
>                     # follow the decay chain order, so that we can easily keep track of the mother index                                           
> -                    for res in range(-1,-len(decay_struct[part]["tree"].keys())-1,-1):
> +                    for res in range(-1,-len(list(decay_struct[part]["tree"].keys()))-1,-1):
>                         index_d1=decay_struct[part]['mg_tree'][-res-1][1]
>                         index_d2=decay_struct[part]['mg_tree'][-res-1][2]
> 
> @@ -3596,7 +3621,7 @@
>                     # follow the decay chain order, so that we can easily keep track of the mother index
> 
>                     map_to_part_number={}
> -                    for res in range(-1,-len(decay_struct[part]["tree"].keys())-1,-1):
> +                    for res in range(-1,-len(list(decay_struct[part]["tree"].keys()))-1,-1):
>                         index_res_for_mom=decay_struct[part]['mg_tree'][-res-1][0]
>                         if (res==-1):
>                             part_number+=1
> @@ -3736,8 +3761,8 @@
>                                 d2colup2=colup2
>                                 d2colup1=maxcol                        
>                         else:
> -                            raise Exception, 'color combination not treated by MadSpin (yet). (%s,%s,%s)' \
> -                                % (colord1,colord2,colormother)
> +                            raise Exception('color combination not treated by MadSpin (yet). (%s,%s,%s)' \
> +                                % (colord1,colord2,colormother))
>                         part_number+=1
>                         index_d1_for_mom=decay_struct[part]['mg_tree'][-res-1][1]
>                         mom=momenta_in_decay[index_d1_for_mom].copy()
> @@ -3819,14 +3844,14 @@
>                     mothup1=curr_event.resonance[part]["mothup1"]         
>                     mothup2=curr_event.resonance[part]["mothup2"] 
>                     if mothup1==index:
> -                        if mothup2!=index: print "Warning: mothup1!=mothup2"
> +                        if mothup2!=index: print("Warning: mothup1!=mothup2")
>                         curr_event.resonance[part]["mothup1"]=part_number
>                         curr_event.resonance[part]["mothup2"]=part_number
>                 for part in curr_event.particle.keys():
>                     mothup1=curr_event.particle[part]["mothup1"]         
>                     mothup2=curr_event.particle[part]["mothup2"] 
>                     if mothup1==index:
> -                        if mothup2!=index: print "Warning: mothup1!=mothup2"
> +                        if mothup2!=index: print("Warning: mothup1!=mothup2")
>                         curr_event.particle[part]["mothup1"]=part_number
>                         curr_event.particle[part]["mothup2"]=part_number
> 
> @@ -3844,7 +3869,7 @@
>         max_br = max([m['total_br'] for m in self.all_ME.values()])
>         if max_br >= 1:
>             if max_br > 1.0001:
> -                raise MadSpinError, 'BR is larger than one.'
> +                raise MadSpinError('BR is larger than one.')
>             max_br = 1
>         for production in self.all_ME.values():
>             if production['total_br'] < max_br:
> @@ -3966,30 +3991,45 @@
>             for (mode, path) in self.calculator:
>                 if mode=='decay':
>                     external = self.calculator[(mode, path)]
> +                    try:
> +                        external.stdin.close()
> +                    except Exception as  error:
> +                        misc.sprint(error)
> +                        continue
> +                    try:
> +                        external.stdout.close()
> +                    except Exception as error:
> +                        misc.sprint(error)
> +                        continue
>                     external.terminate()
>                     del external
>                 elif mode=='full':
> -                    stdin_text="5 0 0 0 0\n"  # before closing, write down the seed 
> +                    stdin_text="5 0 0 0 0\n".encode()  # before closing, write down the seed 
>                     external = self.calculator[('full',path)]
>                     try:
>                         external.stdin.write(stdin_text)
> -                    except Exception:
> +                        external.stdin.flush() 
> +                    except Exception as error:
> +                        misc.sprint(error)
> +                        raise
>                         continue
> -                    ranmar_state=external.stdout.readline()
> +                    ranmar_state=external.stdout.readline().decode()
>                     ranmar_file=pjoin(path,'ranmar_state.dat')
>                     ranmar=open(ranmar_file, 'w')
>                     ranmar.write(ranmar_state)
>                     ranmar.close()
>                     try:
>                         external.stdin.close()
> -                    except Exception:
> -                        continue
> +                    except Exception as  error:
> +                        misc.sprint(error)
>                     try:
>                         external.stdout.close()
> -                    except Exception:
> -                        continue
> +                    except Exception as error:
> +                        misc.sprint(error)                   
>                     external.terminate()
>                     del external
> +                else:
> +                    misc.sprint('not closed', mode, type(mode))
>         else:
>             try:
>                 external = self.calculator[('full', path_to_decay)]
> @@ -3997,12 +4037,21 @@
>                 pass
>             else:
>                 stdin_text="5 0 0 0 0"
> -                external.stdin.write(stdin_text)
> -                external.stdin.close()
> -                external.stdout.close()
> +                try:
> +                    external.stdin.write(stdin_text)
> +                except Exception:
> +                    pass
> +                try:
> +                    external.stdin.close()
> +                except Exception:
> +                    pass
> +                try:
> +                    external.stdout.close()
> +                except Exception:
> +                    pass
>                 external.terminate()       
>                 del external
> -
> +            
>         self.calculator = {}
> 
> 
> @@ -4058,7 +4107,7 @@
>                 if name == 'all':
>                     continue
>                 #self.banner.get('proc_card').get('multiparticles'):
> -                mgcmd.do_define("%s = %s" % (name, ' '.join(`i` for i in pdgs)))
> +                mgcmd.do_define("%s = %s" % (name, ' '.join(repr(i) for i in pdgs)))
> 
> 
>         mgcmd.exec_cmd("set group_subprocesses False")
> @@ -4087,7 +4136,7 @@
>         # 4. compute the full matrix element -----------------------------------
>         logger.info('generating the full matrix element squared (with decay)')
> #        start = time.time()
> -        to_decay = self.mscmd.list_branches.keys()
> +        to_decay = list(self.mscmd.list_branches.keys())
>         decay_text = []
>         for decays in self.mscmd.list_branches.values():
>             for decay in  decays:
> @@ -4172,6 +4221,8 @@
> 
>     def compile(self):
>         logger.info('Compiling code')
> +        #my_env = os.environ.copy()
> +        #os.environ["GFORTRAN_UNBUFFERED_ALL"] = "y"
>         misc.compile(cwd=pjoin(self.path_me,'madspin_me', 'Source'),
>                      nb_core=self.mgcmd.options['nb_core'])        
>         misc.compile(['all'],cwd=pjoin(self.path_me,'madspin_me', 'SubProcesses'),
> 
> === modified file 'MadSpin/interface_madspin.py'
> --- MadSpin/interface_madspin.py	2020-06-16 19:24:01 +0000
> +++ MadSpin/interface_madspin.py	2021-03-24 10:12:56 +0000
> @@ -14,6 +14,8 @@
> ################################################################################
> """ Command interface for MadSpin """
> from __future__ import division
> +from __future__ import absolute_import
> +from __future__ import print_function
> import collections
> import logging
> import math
> @@ -24,6 +26,8 @@
> import sys
> import time
> import glob
> +import six
> +from six.moves import range
> 
> 
> pjoin = os.path.join
> @@ -150,6 +154,7 @@
>         self.mg5cmd = master_interface.MasterCmd()
>         self.seed = None
>         self.err_branching_ratio = 0
> +        self.me_run_name = "" # Events diretory name where to stotre the events (used by madevent) not use internally
> 
> 
>         if event_path:
> @@ -254,7 +259,7 @@
>         process = self.banner.get_detail('proc_card', 'generate')
>         if not process:
>             msg = 'Invalid proc_card information in the file (no generate line):\n %s' % self.banner['mg5proccard']
> -            raise Exception, msg
> +            raise Exception(msg)
>         process, option = mg_interface.MadGraphCmd.split_process_line(process)
>         self.proc_option = option
> 
> @@ -414,7 +419,7 @@
>                 logger.warning("polarization option used with spinmode=onshell. This combination is not validated and is by construction using sub-optimal method which can likely lead to bias in some situation. Use at your own risk.")
> 
>         decay_process, init_part = self.decay.reorder_branch(decaybranch)
> -        if not self.list_branches.has_key(init_part):
> +        if init_part not in self.list_branches:
>             self.list_branches[init_part] = []
>         self.list_branches[init_part].append(decay_process)
>         del decay_process, init_part    
> @@ -446,14 +451,6 @@
>             except ValueError:
>                 raise self.InvalidCmd('second argument should be a real number.')
> 
> -        elif args[0] == 'BW_effect':
> -            if args[1] in [0, False,'.false.', 'F', 'f', 'False', 'no']:
> -                args[1] = 0
> -            elif args[1] in [1, True,'.true.', 'T', 't', 'True', 'yes']:
> -                args[1] = 1
> -            else:
> -                raise self.InvalidCmd('second argument should be either T or F.')
> -        
>         elif args[0] == 'curr_dir':
>             if not os.path.isdir(args[1]):
>                 raise self.InvalidCmd('second argument should be a path to a existing directory')
> @@ -491,11 +488,9 @@
> 
>         # Format
>         if len(args) == 1:
> -            opts = self.options.keys() + ['seed', "spinmode"]
> +            opts = list(self.options.keys()) + ['seed', "spinmode"]
>             return self.list_completion(text, opts) 
>         elif len(args) == 2:
> -            if args[1] == 'BW_effect':
> -                return self.list_completion(text, ['True', 'False']) 
>             if args[1] == 'ms_dir':
>                 return self.path_completion(text, '.', only_dirs = True)
>         elif args[1] == 'ms_dir':
> @@ -508,20 +503,18 @@
>     def help_set(self):
>         """help the set command"""
> 
> -        print 'syntax: set OPTION VALUE'
> -        print ''
> -        print '-- assign to a given option a given value'
> -        print '   - set max_weight VALUE: pre-define the maximum_weight for the reweighting'
> -        print '   - set BW_effect True|False: [default:True] reshuffle the momenta to describe'
> -        print '       corrrectly the Breit-Wigner of the decayed particle'
> -        print '   - set seed VALUE: fix the value of the seed to a given value.'
> -        print '       by default use the current time to set the seed. random number are'
> -        print '       generated by the python module random using the Mersenne Twister generator.'
> -        print '       It has a period of 2**19937-1.'
> -        print '   - set max_running_process VALUE: allow to limit the number of open file used by the code'
> -        print '       The number of running is raising like 2*VALUE'
> -        print '   - set spinmode=none: mode with simple file merging. No spin correlation attempt.'
> -        print '       This mode allows 3 (and more) body decay.'
> +        print('syntax: set OPTION VALUE')
> +        print('')
> +        print('-- assign to a given option a given value')
> +        print('   - set max_weight VALUE: pre-define the maximum_weight for the reweighting')
> +        print('   - set seed VALUE: fix the value of the seed to a given value.')
> +        print('       by default use the current time to set the seed. random number are')
> +        print('       generated by the python module random using the Mersenne Twister generator.')
> +        print('       It has a period of 2**19937-1.')
> +        print('   - set max_running_process VALUE: allow to limit the number of open file used by the code')
> +        print('       The number of running is raising like 2*VALUE')
> +        print('   - set spinmode=none: mode with simple file merging. No spin correlation attempt.')
> +        print('       This mode allows 3 (and more) body decay.')
> 
>     def do_define(self, line):
>         """ """
> @@ -547,14 +540,14 @@
>         """ """
>         try:
>             return self.mg5cmd.complete_define(*args)
> -        except Exception,error:
> +        except Exception as error:
>             misc.sprint(error)
> 
>     def complete_decay(self, *args):
>         """ """
>         try:
>             return self.mg5cmd.complete_generate(*args)
> -        except Exception,error:
> +        except Exception as error:
>             misc.sprint(error)
> 
>     def check_launch(self, args):
> @@ -568,29 +561,53 @@
>         # Validity check. Need lhe version 3 if matching is on
>         if self.banner.get("run_card", "lhe_version") < 3 and \
>             self.banner.get("run_card", "ickkw") > 0:
> -            raise Exception, "MadSpin requires LHEF version 3 when running with matching/merging"
> +            raise Exception("MadSpin requires LHEF version 3 when running with matching/merging")
> 
>     def help_launch(self):
>         """help for the launch command"""
> 
> -        print '''Running Madspin on the loaded events, following the decays enter
> +        print('''Running Madspin on the loaded events, following the decays enter
>         An example of a full run is the following:
>         import ../mssm_events.lhe.gz
>         define sq = ur ur~
>         decay go > sq j
>         launch
> -        '''
> +        ''')
> +        
> +        self.parser_launch.print_help()
> +
> +    def parser_launch(self):
> +        usage = """launch [-n RUN_NAME]   
> +        """
> +        parser = misc.OptionParser(usage=usage)
> +        parser.add_option("-n", "--name",
> +                  default="",
> +                  help="When NOT run in standalone instruct MG5aMC where to store the events file")
> +        return parser
> +    
> +    def parse_launch(self, line):
> +        
> +        args = self.split_arg(line)
> +        return self.parser_launch().parse_args(args)
> +        
> 
>     @misc.mute_logger()
>     def do_launch(self, line):
>         """end of the configuration launched the code"""
> 
> +        (options, args) = self.parse_launch(line)
> +        
> +        if options.name:
> +            self.me_run_name = options.name # Only use by MG5aMC
> +        else:
> +            self.me_run_name = ''
> +        
>         if self.options["spinmode"] in ["none"]:
>             return self.run_bridge(line)
>         elif self.options["spinmode"] == "onshell":
>             return self.run_onshell(line)
>         elif self.options["spinmode"] == "bridge":
> -            raise Exception, "Bridge mode not available."
> +            raise Exception("Bridge mode not available.")
> 
>         if self.options['ms_dir'] and os.path.exists(pjoin(self.options['ms_dir'], 'madspin.pkl')):
>             return self.run_from_pickle()
> @@ -622,7 +639,7 @@
> 
>         if self.options['seed'] > 30081*30081: # can't use too big random number
>             msg = 'Random seed too large ' + str(self.options['seed']) + ' > 30081*30081'
> -            raise Exception, msg
> +            raise Exception(msg)
> 
>         #self.options['seed'] = self.seed
>         text = '%s\n' % '\n'.join([ line for line in self.history if line])
> @@ -716,13 +733,13 @@
> 
>             orig_block = generate_all.banner.param_card[name]
>             if block != orig_block:                
> -                raise Exception, """The directory %s is specific to a mass spectrum. 
> +                raise Exception("""The directory %s is specific to a mass spectrum. 
>                 Your event file is not compatible with this one. (Different param_card: %s different)
>                 orig block:
>                 %s
>                 new block:
>                 %s""" \
> -                % (self.options['ms_dir'], name, orig_block, block)
> +                % (self.options['ms_dir'], name, orig_block, block))
> 
>         #replace init information
>         generate_all.banner['init'] = self.banner['init']
> @@ -808,7 +825,7 @@
>             elif '.hepmc' in filename:
>                 self.options['input_format']  = 'hepmc'
>             else:
> -                raise Exception, "fail to recognized input format automatically"
> +                raise Exception("fail to recognized input format automatically")
> 
>         if self.options['input_format'] in ['lhe', 'lhe_no_banner']:
>             orig_lhe = lhe_parser.EventFile(filename)
> @@ -849,7 +866,7 @@
> 
>         if self.options['seed'] > 30081*30081: # can't use too big random number
>             msg = 'Random seed too large ' + str(self.options['seed']) + ' > 30081*30081'
> -            raise Exception, msg
> +            raise Exception(msg)
> 
>         #self.options['seed'] = self.options['seed']
> 
> @@ -989,7 +1006,7 @@
> 
>         for event in orig_lhe:
>             if counter and counter % 100 == 0 and float(str(counter)[1:]) ==0:
> -                print "decaying event number %s [%s s]" % (counter, time.time()-start)
> +                print("decaying event number %s [%s s]" % (counter, time.time()-start))
>             counter +=1
> 
>             # use random order for particles to avoid systematics when more than 
> @@ -1058,7 +1075,7 @@
>                     # read the event file up to completion
>                     while 1:
>                         try:
> -                            decay = decay_file.next()
> +                            decay = next(decay_file)
>                         except StopIteration:
>                             # check how far we are
>                             ratio = counter / nb_event 
> @@ -1069,6 +1086,7 @@
>                             evt_decayfile[particle.pdg].update(new_file)
>                             decay_file = evt_decayfile[particle.pdg][decay_file_nb]
>                             continue
> +
>                         if helicity == decay[0].helicity or helicity==9 or \
>                                             self.options["spinmode"] == "none":
>                             break # use that event
> @@ -1198,7 +1216,7 @@
>                         try:
>                             os.remove(pjoin(decay_dir, 'Cards', 'madanalysis5_parton_card_default.dat'))
>                             os.remove(pjoin(decay_dir, 'Cards', 'madanalysis5_parton_card.dat'))
> -                        except Exception,error:
> +                        except Exception as error:
>                             logger.debug(error)
>                             pass 
>                         self.me_int[decay_dir] = me5_cmd
> @@ -1245,7 +1263,7 @@
>                     try:
>                         os.remove(pjoin(decay_dir, 'Cards', 'madanalysis5_parton_card_default.dat'))
>                         os.remove(pjoin(decay_dir, 'Cards', 'madanalysis5_parton_card.dat'))
> -                    except Exception,error:
> +                    except Exception as error:
>                         logger.debug(error)
>                         pass                 
>                     self.me_int[decay_dir] = me5_cmd
> @@ -1282,6 +1300,16 @@
>                 me5_cmd.exec_cmd("exit")
>                 out[i] = lhe_parser.EventFile(pjoin(decay_dir, "Events", 'run_01', 'unweighted_events.lhe.gz'))            
>             else:
> +                if not self.seed:
> +                    if hasattr(self, 'mother'):
> +                        try:
> +                            self.seed = 100 + self.mother.run_card['iseed']
> +                        except:
> +                            self.seed = random.randint(0, int(30081*30081))
> +                self.seed += 1
> +                if self.seed > 30081*30081:
> +                    self.seed -= 30081*30081        
> +                logger.info('Will use seed %s' % (self.seed))
>                 misc.call(['run.sh', str(int(1.2*nb_event)), str(self.seed)], cwd=decay_dir)     
>                 out[i] = lhe_parser.EventFile(pjoin(decay_dir, 'events.lhe.gz'))            
>             if cumul:
> @@ -1360,7 +1388,7 @@
> 
>         if self.seed > 30081*30081: # can't use too big random number
>             msg = 'Random seed too large ' + str(self.seed) + ' > 30081*30081'
> -            raise Exception, msg
> +            raise Exception(msg)
> 
>         self.options['seed'] = self.seed
> 
> @@ -1538,7 +1566,7 @@
>             # file if needed.
>             while 1:
>                 try:
> -                    decay = decay_file.next()
> +                    decay = next(decay_file)
>                     break
>                 except StopIteration:
>                     eff = self.efficiency
> @@ -1580,7 +1608,7 @@
>                 logger.info( "Event %s/%s :  %2fs" % (i, nevents, time.time()-start))
>             maxwgt = 0
>             orig_lhe.seek(0)
> -            base_event = orig_lhe.next()
> +            base_event = next(orig_lhe)
>             if self.options['fixed_order']:
>                 base_event = base_event[0]
>             for j in range(self.options['max_weight_ps_point']):
> @@ -1674,8 +1702,12 @@
>                 sys.path.insert(0, pjoin(self.path_me, 'madspin_me', 'SubProcesses'))
> 
>             mymod = __import__("%s.matrix2py" % (pdir))
> +            if six.PY3:
> +                from importlib import reload
> +            else:
> +                from imp import reload
>             reload(mymod)
> -            mymod = getattr(mymod, 'matrix2py')
> +            mymod = getattr(mymod, 'matrix2py')  
>             with misc.chdir(pjoin(self.path_me, 'madspin_me', 'SubProcesses', pdir)):
>                 with misc.stdchannel_redirected(sys.stdout, os.devnull):
>                     if not os.path.exists(pjoin(self.path_me, 'Cards','param_card.dat')) and \
> @@ -1718,7 +1750,7 @@
>                 try:
>                     proc_nb = int(proc_nb)
>                 except ValueError:
> -                    raise MadSpinError, 'MadSpin didn\'t allow order restriction after the @ comment: \"%s\" not valid' % proc_nb
> +                    raise MadSpinError('MadSpin didn\'t allow order restriction after the @ comment: \"%s\" not valid' % proc_nb)
>                 proc_nb = '@ %i' % proc_nb 
>                 if self.options['global_order_coupling']:
>                     proc_nb = '%s %s' % (proc_nb, self.options['global_order_coupling'])
> 
> === modified file 'MadSpin/src/lha_read_ms.f'
> --- MadSpin/src/lha_read_ms.f	2012-12-12 17:38:07 +0000
> +++ MadSpin/src/lha_read_ms.f	2021-03-24 10:12:56 +0000
> @@ -261,7 +261,7 @@
> 
> 
> 
> -      subroutine LHA_get_real(npara,param,value,name,var,def_value_num)
> +      subroutine LHA_get_real_silent(npara,param,value,name,var,def_value_num)
> c----------------------------------------------------------------------------------
> c     finds the parameter named "name" in param and associate to "value" in value
> c----------------------------------------------------------------------------------
> @@ -284,12 +284,17 @@
> c
> c     local
> c
> -      logical found
> +      logical found, log
>       integer i
> +
> +      log = .false.
> +      goto 10
> +      entry LHA_get_real(npara,param,value,name,var,def_value_num)
> c
> c     start
> c
> -      i=1
> +      
> + 10   i=1
>       found=.false.
>       do while(.not.found.and.i.le.npara)
>          ctemp=param(i)
> @@ -305,8 +310,10 @@
>          i=i+1
>       enddo
>       if (.not.found) then
> -         write (*,*) "Warning: parameter ",name," not found"
> -         write (*,*) "         setting it to default value ",def_value_num
> +         if (log) then
> +            write (*,*) "Warning: parameter ",name," not found"
> +            write (*,*) "         setting it to default value ",def_value_num
> +         endif
>          var=def_value_num
>       endif
> 
> 
> === modified file 'Template/LO/Cards/pythia8_card_default.dat'
> --- Template/LO/Cards/pythia8_card_default.dat	2017-02-06 18:35:42 +0000
> +++ Template/LO/Cards/pythia8_card_default.dat	2021-03-24 10:12:56 +0000
> @@ -12,6 +12,8 @@
> ! -------------------------------------------------------------------
> ! Specify the HEPMC output of the Pythia8 shower. You can set it to:
> !   auto      : MG5aMC will automatically place it the run_<i> directory
> +!   autoremove: MG5aMC will automatically remove the file at the end of the run.
> +!                (usefull when running with Delphes)
> !   /dev/null : to turn off the HEPMC output.
> !   <path>    : to select where the HEPMC file must written. It will 
> !               therefore not be placed in the run_<i> directory. The
> 
> === modified file 'Template/LO/Cards/run_card.dat'
> --- Template/LO/Cards/run_card.dat	2020-05-27 07:52:34 +0000
> +++ Template/LO/Cards/run_card.dat	2021-03-24 10:12:56 +0000
> @@ -28,7 +28,7 @@
> #*********************************************************************
> # Collider type and energy                                           *
> # lpp: 0=No PDF, 1=proton, -1=antiproton, 2=photon from proton,      *
> -#                                         3=photon from electron     *
> +#                3=photon from electron, 4=photon from muon          *
> #*********************************************************************
>      %(lpp1)s        = lpp1    ! beam 1 type 
>      %(lpp2)s        = lpp2    ! beam 2 type
> @@ -58,16 +58,19 @@
>   %(gridpack)s     = gridpack  !True = setting up the grid pack
>   %(time_of_flight)s = time_of_flight ! threshold (in mm) below which the invariant livetime is not written (-1 means not written)
>   %(event_norm)s =  event_norm       ! average/sum. Normalization of the weight in the LHEF
> -$MLM
> -$CKKW
> +$mlm
> +$ckkw
> #*********************************************************************
> #
> #*********************************************************************
> -# handling of the helicities:
> -#  0: sum over all helicities
> -#  1: importance sampling over helicities
> +# Phase-Space Optimization strategy (basic options)
> #*********************************************************************
>    %(nhel)s  = nhel          ! using helicities importance sampling or not.
> +                             ! 0: sum over helicity, 1: importance sampling
> +   %(sde_strategy)s  = sde_strategy  ! default integration strategy (hep-ph/2021.xxxxx)
> +                             ! 1 is old strategy (using amp square)
> +			     ! 2 is new strategy (using only the denominator)
> +$psoptim			     
> #*********************************************************************
> # Generation bias, check the wiki page below for more information:   *
> #  'cp3.irmp.ucl.ac.be/projects/madgraph/wiki/LOEventGenerationBias' *
> 
> === modified file 'Template/LO/Source/.make_opts'
> --- Template/LO/Source/.make_opts	2019-01-23 16:03:38 +0000
> +++ Template/LO/Source/.make_opts	2021-03-24 10:12:56 +0000
> @@ -13,10 +13,11 @@
> 
> # Rest of the makefile
> ifeq ($(origin FFLAGS),undefined)
> -FFLAGS= -O -w -fbounds-check -fPIC
> +FFLAGS= -w -fPIC
> #FFLAGS+= -g -fbounds-check -ffpe-trap=invalid,zero,overflow,underflow,denormal -Wall
> endif
> 
> +FFLAGS += $(GLOBAL_FLAG)
> 
> # REMOVE MACFLAG IF NOT ON MAC OR FOR F2PY
> UNAME := $(shell uname -s)
> 
> === modified file 'Template/LO/Source/PDF/PhotonFlux.f'
> --- Template/LO/Source/PDF/PhotonFlux.f	2020-03-27 13:59:33 +0000
> +++ Template/LO/Source/PDF/PhotonFlux.f	2021-03-24 10:12:56 +0000
> @@ -6,25 +6,28 @@
> c/* ********************************************************* */
> c   provided by Tomasz Pierzchala - UCL
> 
> -      real*8 function epa_electron(x,q2max)
> -      integer i
> +      real*8 function epa_lepton(x,q2max, mode)
> +      implicit none
> +      integer i, mode, imode
> +c     mode is +3/-3  for electron and +4/-4 for muon      
>       real*8 x,phi_f
> -      real*8 xin
> +      real*8 xin(3:4)
>       real*8 alpha
>       real*8 f, q2min,q2max
>       real*8 PI
>       data PI/3.14159265358979323846/
> 
> -      data xin/0.511d-3/ !electron mass in GeV
> +      data xin/0.511d-3, 0.105658d0/ !electron mass in GeV
> 
>       alpha = .0072992701
> -
> +      imode = abs(mode)
> +      
> C     // x = omega/E = (E-E')/E
>       if (x.lt.1) then
> -         q2min= xin*xin*x*x/(1-x)
> +         q2min= xin(imode)*xin(imode)*x*x/(1-x)
>          if(q2min.lt.q2max) then 
> -            f = alpha/2d0/PI*
> -     &           (2d0*xin*xin*x*(-1/q2min+1/q2max)+
> +             f = alpha/2d0/PI*
> +     &           (2d0*xin(imode)*xin(imode)*x*(-1/q2min+1/q2max)+
>      &           (2-2d0*x+x*x)/x*dlog(q2max/q2min))
> 
>          else
> @@ -35,7 +38,7 @@
>       endif
> c      write (*,*) x,dsqrt(q2min),dsqrt(q2max),f
>       if (f .lt. 0) f = 0
> -      epa_electron= f
> +      epa_lepton = f
> 
>       end
> 
> 
> === modified file 'Template/LO/Source/PDF/pdf.f'
> --- Template/LO/Source/PDF/pdf.f	2018-02-01 23:17:18 +0000
> +++ Template/LO/Source/PDF/pdf.f	2021-03-24 10:12:56 +0000
> @@ -29,7 +29,7 @@
>       double precision u_val,d_val,u_sea,d_sea,s_sea,c_sea,b_sea,gluon
>       double precision Ctq3df,Ctq4Fn,Ctq5Pdf,Ctq6Pdf,Ctq5L
>       double precision q2max
> -      double precision epa_electron,epa_proton
> +      double precision epa_lepton,epa_proton
>       include 'pdf.inc'
> 
>       integer mode,Iprtn,Irt
> @@ -297,9 +297,14 @@
> c  a "diffractive" photon
> c      
>       q2max=xmu*xmu
> -      if(ih .eq. 3) then  !from the electron
> -          fx(7)=epa_electron(x,q2max)
> -      elseif(ih .eq. 2) then  !from a proton without breaking
> +      if(abs(ih) .eq. 3.or.abs(ih) .eq. 4) then !from the electron
> +         write(*,*) 'impossible call (or was it) to pdf-> please reporrt'
> +         stop 23
> +         fx(7)=epa_lepton(x,q2max, ih)
> +      elseif(ih .eq. 2) then    !from a proton without breaking
> +         write(*,*) 'impossible call (or was it) to pdf-> please reporrt'
> +         stop 23
> +         ! isssue with next call since this function takes now a third argument (beamid not define here)
>           fx(7)=epa_proton(x,q2max)
>       endif      
> 
> 
> === removed file 'Template/LO/Source/PDF/pdf_lhapdf.f'
> === modified file 'Template/LO/Source/PDF/pdg2pdf.f'
> --- Template/LO/Source/PDF/pdg2pdf.f	2019-12-04 21:34:25 +0000
> +++ Template/LO/Source/PDF/pdg2pdf.f	2021-03-24 10:12:56 +0000
> @@ -24,7 +24,7 @@
>       integer mode,Irt,i,j
>       double precision xlast(2),xmulast(2),pdflast(-7:7,2),q2max
>       character*7 pdlabellast(2)
> -      double precision epa_electron,epa_proton
> +      double precision epa_lepton,epa_proton
>       integer ipart,ireuse,iporg,ihlast(2)
>       save xlast,xmulast,pdflast,pdlabellast,ihlast
>       data xlast/2*-99d9/
> @@ -131,8 +131,8 @@
> 
>       if(iabs(ipart).eq.7.and.ih.gt.1) then
>          q2max=xmu*xmu
> -         if(ih.eq.3) then       !from the electron
> -            pdg2pdf=epa_electron(x,q2max)
> +         if(abs(ih).eq.3.or.abs(ih).eq.4) then       !from the electron or muonn
> +            pdg2pdf=epa_lepton(x,q2max, ih)
>          elseif(ih .eq. 2) then !from a proton without breaking
>             pdg2pdf=epa_proton(x,q2max,beamid)
>          endif 
> 
> === removed file 'Template/LO/Source/PDF/pdg2pdf_lhapdf.f'
> === modified file 'Template/LO/Source/PDF/pdg2pdf_lhapdf6.f'
> --- Template/LO/Source/PDF/pdg2pdf_lhapdf6.f	2020-03-06 20:47:59 +0000
> +++ Template/LO/Source/PDF/pdg2pdf_lhapdf6.f	2021-03-24 10:12:56 +0000
> @@ -24,7 +24,7 @@
>       integer i,j,ihlast(20),ipart,iporg,ireuse,imemlast(20),iset,imem
>      &     ,i_replace,ii,ipartlast(20)
>       double precision xlast(20),xmulast(20),pdflast(-7:7,20)
> -      double precision epa_proton, epa_electron
> +      double precision epa_proton, epa_lepton
>       save ihlast,xlast,xmulast,pdflast,imemlast,ipartlast
>       data ihlast/20*-99/
>       data ipartlast/20*-99/
> @@ -139,10 +139,11 @@
>             pdg2pdf = get_ion_pdf(pdflast(-7, i_replace), ipart, nb_proton(beamid), nb_neutron(beamid))
>          endif
>          pdg2pdf=pdg2pdf/x
> -      else if(ih.eq.3) then       !from the electron
> -            pdg2pdf=epa_electron(x,xmu*xmu)
> +      else if(abs(ih).eq.3.or.abs(ih).eq.4) then       !from the electron
> +            pdg2pdf=epa_lepton(x,xmu*xmu, ih)
>       else if(ih.eq.2) then ! photon from a proton without breaking
> -          pdg2pdf = epa_proton(x,xmu*xmu)
> +          pdg2pdf = epa_proton(x,xmu*xmu, beamid)
> +
>       else
>          write (*,*) 'beam type not supported in lhadpf'
>          stop 1
> 
> === modified file 'Template/LO/Source/dsample.f'
> --- Template/LO/Source/dsample.f	2020-05-13 09:45:34 +0000
> +++ Template/LO/Source/dsample.f	2021-03-24 10:12:56 +0000
> @@ -257,6 +257,7 @@
> c     Need to start from scratch. This is clunky but I'll just
> c     remove the grid, so we are clean
> c
> +      goto 200
>       write(*,*) "Trying w/ fresh grid"
>       open(unit=25,file='ftn25',status='unknown',err=102)
>       write(25,*) ' '
> @@ -329,7 +330,7 @@
> c
> c     All done
> c
> -      open(unit=66,file='results.dat',status='unknown')
> +200   open(unit=66,file='results.dat',status='unknown')
>       i=1
>       do while(xmean(i) .ne. 0 .and. i .lt. cur_it)
>          i=i+1
> @@ -453,6 +454,10 @@
>       CUMULATED_TIMING = t_after - CUMULATED_TIMING
> 
>       if (N_EVALS.eq.0) then
> +         write(outUnit,*) '<lo_statistics> '
> +         write(outUnit,*) '<cumulated_time>'//trim(toStr_real(CUMULATED_TIMING))
> +     &        //'</cumulated_time>'
> +         write(outUnit,*) '</lo_statistics>'
>         return
>       endif
> 
> @@ -2270,7 +2275,11 @@
>       integer                                      nsteps
>       character*40          result_file,where_file
>       common /sample_status/result_file,where_file,nsteps
> -
> +c
> +c     
> +c
> +       logical init_mode
> +       common/to_determine_zero_hel/init_mode
> c----
> c  Begin Code
> c----
> @@ -2278,6 +2287,9 @@
>          write(*,*) nb_pass_cuts, 
>      &    ' points passed the cut but all returned zero'
>          write(*,*) 'therefore considering this contribution as zero'
> +         if (init_mode) then
> +            call print_zero_amp()
> +         endif
>       else if (nb_pass_cuts.gt.0.and.nb_pass_cuts.lt.1000)then
>          write(*,*) 'only', nb_pass_cuts, 
>      &    ' points passed the cut and they all returned zero'
> 
> === modified file 'Template/LO/Source/invarients.f'
> --- Template/LO/Source/invarients.f	2011-04-16 05:25:14 +0000
> +++ Template/LO/Source/invarients.f	2021-03-24 10:12:56 +0000
> @@ -185,10 +185,10 @@
>       end
> 
> 
> -      subroutine map_invarients(Minvar,nconfigs,ninvar,mincfig,maxcfig,nexternal,nincoming)
> +      subroutine map_invarients(Minvar,nconfigs,ninvar,mincfig,maxcfig,nexternal,nincoming,nb_tchannel)
> c****************************************************************************
> c     Determines mappings for each structure of invarients onto integration
> -c     variables.  Input: Ninvar, iforest.  Output: Minvar, ninvar
> +c     variables.  Input: Ninvar, iforest.  Output: Minvar, ninvar, nb_tchannel
> c****************************************************************************
>       implicit none
> c
> @@ -201,11 +201,13 @@
> c
>       integer Minvar(maxdim,lmaxconfigs),nconfigs,ninvar,nexternal,nincoming
>       integer mincfig,maxcfig
> +      integer nb_tchannel
> c
> c     Local
> c
>       integer iconfig, jgrid,j, nbranch
>       logical found,tchannel
> +      integer ns_channel
> c
> c     Global
> c
> @@ -224,20 +226,30 @@
> c     
> c     Try simple mapping if nconfigs = 1
> c
> -
> +      nb_tchannel = 0
>       if (nconfigs .eq. 1) then
> c         do j=1,3*nbranch-4+2
>          do j=1,maxdim
>             minvar(j,mincfig)=j
>          enddo
>          jgrid=j-1
> +
> +         write(*,*) 'Determine nb_t'
> +         ns_channel=1
> +         do while((iforest(1,-ns_channel,mincfig) .ne. 1.and.iforest(1,-ns_channel,mincfig) .ne. 2).and.ns_channel.lt.nbranch)
> +            ns_channel=ns_channel+1
> +         enddo
> +         ns_channel=ns_channel - 1
> +         nb_tchannel=nbranch-ns_channel-1
> +         write(*,*) 'T-channel found: ',nb_tchannel 
> +         
>       else
> c      if (ep) jgrid=1
> c      if (pp) jgrid=2
>       do iconfig=mincfig,maxcfig
>          tchannel = .false.         
>          do j=1,nbranch-1
> -            if (iforest(1,-j,iconfig) .eq. 1) then
> +            if (iforest(1,-j,iconfig) .eq. 1.or.(nincoming.eq.2.and.iforest(1,-j,iconfig) .eq. 2)) then
>                tchannel=.true.
>             endif
>             jgrid=jgrid+1
> 
> === modified file 'Template/LO/Source/kin_functions.f'
> --- Template/LO/Source/kin_functions.f	2016-02-10 14:56:17 +0000
> +++ Template/LO/Source/kin_functions.f	2021-03-24 10:12:56 +0000
> @@ -590,11 +590,13 @@
> C     4-Vector Dot product
> C****************************************************************************
>       implicit none
> -      double precision p1(0:3),p2(0:3)
> +      double precision p1(0:3),p2(0:3), dot2
>       dot=p1(0)*p2(0)-p1(1)*p2(1)-p1(2)*p2(2)-p1(3)*p2(3)
> 
> -      if(dabs(dot).lt.1d-6)then ! solve numerical problem 
> -         dot=0d0
> +      if(dabs(dot).lt.1d-6)then ! solve numerical problem
> +         dot2 = p1(0)*p2(0)+p1(1)*p2(1)+p1(2)*p2(2)+p1(3)*p2(3)
> +         dot2 = max(1e-99,dot2)
> +         if (dot/dot2.lt.1e-6) dot=0d0
>       endif
> 
>       end
> 
> === modified file 'Template/LO/Source/run.inc'
> --- Template/LO/Source/run.inc	2019-03-23 22:04:23 +0000
> +++ Template/LO/Source/run.inc	2021-03-24 10:12:56 +0000
> @@ -97,4 +97,9 @@
>      &etamax4pdg, mxxmin4pdg,mxxpart_antipart
> 
>        double precision small_width_treatment
> -       common/narrow_width/small_width_treatment
> \ No newline at end of file
> +       common/narrow_width/small_width_treatment
> +
> +       double precision tmin_for_channel
> +       integer sde_strat ! 1 means standard single diagram enhancement strategy,
> +c                          2 means approximation by the denominator of the propagator
> +       common/TO_CHANNEL_STRAT/tmin_for_channel, sde_strat
> \ No newline at end of file
> 
> === modified file 'Template/LO/Source/run_printout.f'
> --- Template/LO/Source/run_printout.f	2012-03-22 06:16:35 +0000
> +++ Template/LO/Source/run_printout.f	2021-03-24 10:12:56 +0000
> @@ -22,12 +22,17 @@
>       write(6,*)  'Collider parameters:'
>       write(6,*)  '--------------------'
> 
> +      ab(1) = '?'
> +      ab(2) = '?'
>       do i=1,2
>          IF(LPP(i).EQ. 0) ab(i)='e'
>          IF(LPP(i).EQ. 1) ab(i)='P'
>          IF(LPP(i).EQ.-1) ab(i)='Pb'
> -         IF(LPP(i).EQ.2) ab(i)='a2'
> -         IF(LPP(i).EQ.3) ab(i)='a3'
> +         IF(LPP(i).EQ.2) ab(i)='a'
> +         IF(LPP(i).EQ.3) ab(i)='e-'
> +         IF(LPP(i).EQ.-3) ab(i)='e+'
> +         IF(LPP(i).EQ.4) ab(i)='m-'
> +         IF(LPP(i).EQ.-4) ab(i)='m+'
>       enddo
> 
>       ene=2d0*dsqrt(ebeam(1)*ebeam(2))
> 
> === modified file 'Template/LO/Source/setrun.f'
> --- Template/LO/Source/setrun.f	2016-03-04 16:16:23 +0000
> +++ Template/LO/Source/setrun.f	2021-03-24 10:12:56 +0000
> @@ -83,6 +83,22 @@
>       q2fact(1) = sf1**2      ! fact scale**2 for pdf1
>       q2fact(2) = sf2**2      ! fact scale**2 for pdf2     
> 
> +      if(pb1.ne.0d0)then
> +         if (abs(lpp(1)).eq.1.or.abs(lpp(1)).eq.2)then
> +            write(*,*) 'proton/anti-proton beam polarization are not allowed'
> +            stop 1
> +         endif
> +         pol(1)=sign(1+abs(pb1)/100d0,pb1)
> +      endif
> +      if(pb2.ne.0d0)then
> +         if (abs(lpp(2)).eq.1.or.abs(lpp(2)).eq.2)then
> +            write(*,*) 'proton/anti-proton beam polarization are not allowed'
> +            stop 1
> +         endif
> +         pol(2)=sign(1+abs(pb2)/100d0,pb2)
> +      endif
> +
> +      
>       if(pb1.ne.0d0.and.lpp(1).eq.0) pol(1)=sign(1+abs(pb1)/100d0,pb1)
>       if(pb2.ne.0d0.and.lpp(2).eq.0) pol(2)=sign(1+abs(pb2)/100d0,pb2)
> 
> 
> === modified file 'Template/LO/SubProcesses/cluster.f'
> --- Template/LO/SubProcesses/cluster.f	2013-03-21 12:45:09 +0000
> +++ Template/LO/SubProcesses/cluster.f	2021-03-24 10:12:56 +0000
> @@ -210,7 +210,8 @@
>       integer ignum, ipnum, ipids(nexternal,4,2:nexternal)
> C $B$ IFOREST $B$ !this is a tag for MadWeight
>       integer i, iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest, tstrategy
>       integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
>       integer tprid(-max_branch:-1,lmaxconfigs)
>       common/to_sprop/sprop,tprid
> @@ -404,7 +405,8 @@
>       common/to_mconfigs/mapconfig, this_config
> C $B$ IFOREST $B$ !this is a tag for MadWeight
>       integer i, iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest,	tstrategy
> C $E$ IFOREST $E$ !this is a tag for MadWeight
> C $B$ DECAYBW $E$ !this is a tag for MadWeight
> 
> 
> === removed file 'Template/LO/SubProcesses/dipole.inc'
> === removed file 'Template/LO/SubProcesses/dipolesub.f'
> === removed file 'Template/LO/SubProcesses/epsterms.f'
> === removed file 'Template/LO/SubProcesses/finiteterms.f'
> === modified file 'Template/LO/SubProcesses/genps.f'
> --- Template/LO/SubProcesses/genps.f	2020-06-15 07:16:51 +0000
> +++ Template/LO/SubProcesses/genps.f	2021-03-24 10:12:56 +0000
> @@ -163,7 +163,8 @@
> 
> 
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/ iforest, tstrategy
> 
>       integer            mapconfig(0:lmaxconfigs), this_config
>       common/to_mconfigs/mapconfig, this_config
> @@ -321,7 +322,7 @@
>       endif
>       pswgt = 1d0
>       jac   = 1d0
> -      call one_tree(iforest(1,-max_branch,iconfig),mincfig,
> +      call one_tree(iforest(1,-max_branch,iconfig), tstrategy(iconfig),mincfig,
>      &     nbranch,P,M,S,X,jac,pswgt)
> c
> c     Add what I think are the essentials
> @@ -520,7 +521,7 @@
>       integer nbranch,ndim,nconfigs
>       integer ninvar
>       integer nparticles,nfinal
> -
> +      integer nb_tchannel
> 
> c
> c     Arguments
> @@ -572,6 +573,8 @@
>             if (abs(lpp(2)) .eq. 1 .or. abs(lpp(2)) .eq. 2) m2 = 0.938d0
>             if (abs(lpp(1)) .eq. 3) m1 = 0.000511d0
>             if (abs(lpp(2)) .eq. 3) m2 = 0.000511d0
> +            if (abs(lpp(1)) .eq. 4) m1 = 0.105658d0
> +            if (abs(lpp(2)) .eq. 4) m2 = 0.105658d0
>             if (mass_ion(1).ge.0d0) m1 = mass_ion(1)
>             if (mass_ion(2).ge.0d0) m2 = mass_ion(2)
>             if(ebeam(1).lt.m1.and.lpp(1).ne.9) ebeam(1)=m1
> @@ -593,7 +596,7 @@
>          nconfigs = 1
>          mincfig=iconfig
>          maxcfig=iconfig
> -         call map_invarients(minvar,nconfigs,ninvar,mincfig,maxcfig,nexternal,nincoming)
> +         call map_invarients(minvar,nconfigs,ninvar,mincfig,maxcfig,nexternal,nincoming,nb_tchannel)
>          maxwgt=0d0
>          nparticles   = nexternal
>          nfinal       = nparticles-nincoming
> @@ -630,7 +633,7 @@
>       return
>       end
> 
> -      subroutine one_tree(itree,iconfig,nbranch,P,M,S,X,jac,pswgt)
> +      subroutine one_tree(itree,tstrategy,iconfig,nbranch,P,M,S,X,jac,pswgt)
> c************************************************************************
> c     Calculates the momentum for everything below in the tree until
> c     it reaches the end.
> @@ -650,8 +653,10 @@
> c     Arguments
> c
>       integer itree(2,-max_branch:-1) !Structure of configuration
> +      integer tstrategy ! current strategy for t-channel
>       integer iconfig                 !Which configuration working on
>       double precision P(0:3,-max_branch:max_particles)
> +      double precision pother(0:3), ptemp(0:3), pboost(0:3), ptemp2(0:3)
>       double precision M(-max_branch:max_particles)
>       double precision S(-max_branch:0)
> c      double precision spole(-max_branch:0),swidth(-max_branch:0)
> @@ -662,12 +667,13 @@
> c     Local
> c
>       logical pass
> +      double precision tmass(-max_branch:-1)
>       integer ibranch,i,ns_channel,nt_channel,ix  !,nerr
> -c      data nerr/0/
> +      integer iopposite ! index for t-channel mapping for the part not handle by itree
> +c     data nerr/0/
>       double precision smin,smax,totmass,totmassin,xa2,xb2,wgt
>       double precision costh,phi,tmin,tmax,t
>       double precision ma2,mb2,m12,mn2,s1, mi2
> -      double precision tmass(-max_branch:-1)
> c
> c     External
> c
> @@ -701,7 +707,12 @@
> c     the s channel p1+p2
> c
>       ns_channel=1
> -      do while(itree(1,-ns_channel) .ne. 1 .and.ns_channel.lt.nbranch)
> +      iopposite = 1
> +      if (abs(tstrategy).eq.1) then
> +         iopposite = 2
> +      endif
> +      
> +      do while(itree(1,-ns_channel) .ne. iopposite .and.ns_channel.lt.nbranch)
>          m(-ns_channel)=0d0                 
>          ns_channel=ns_channel+1         
>       enddo
> @@ -711,7 +722,6 @@
>       if (nt_channel .eq. 0 .and. nincoming .eq. 2) then
>          ns_channel=ns_channel-1
>       endif
> -
> c
> c     Determine masses for all intermediate states.  Starting
> c     from outer most (real particle) states
> @@ -809,7 +819,7 @@
>          totmass=totmass-m(itree(2,ibranch))      !for remaining particles
>          smin = totmass**2                        !This affects t_min/max
>          smax = (m(ibranch) - m(itree(2,ibranch)))**2
> -
> +         
>          if (smin .gt. smax) then
>             jac=-3d0
>             return
> @@ -835,18 +845,239 @@
> c
> c     From here, on we can just pretend this is a 2->2 scattering with
> c     Pa                    + Pb     -> P1          + P2
> +
> +      if (tstrategy.eq.-2.or.tstrategy.eq.-1) then
> +ccccccccccccccccccccccccccccccccccccccccccccccccccccccccc  
> +cc       T-channel ping-pong strategy starting with 2
> +ccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +         
> +c     No -flipping case:      
> +c      p(0,itree(ibranch,1)) + p(0,2) -> p(0,ibranch)+ p(0,itree(ibranch,2))
> +c       -  M(ibranch) is the total mass available (Pa+Pb)^2
> +c       - M(ibranch-1) is the mass of P2  (all the remaining particles)
> +c
> +c     With flipping case
> +c      p(0,itree(ibranch,1)) + pother -> p(0,ibranch)+ p(0,itree(ibranch,2))
> +c       - pother = p(0,itree(ibranch,1)) -p(0,itree(ibranch,2))         
> +c       - M(ibranch) is the total mass available (Pa+Pb)^2
> +c       - M(ibranch-1) is the mass of P2  (all the remaining particles)      
> +c
> +c     This assumes that P(0, ibranch) is set to the T-channel propa (likely)
> +c      do ibranch = -ns_channel-1,-nbranch,-1
> +c         totmass=totmass+m(itree(2,ibranch))
> +c      enddo
> +      do ibranch=-ns_channel-1,-nbranch+1,-1
> +c         totmass=totmass-m(itree(2,ibranch))      !for remaining particles
> +c         smin = totmass**2                        !This affects t_min/max
> +c         smax = (m(ibranch) - m(itree(2,ibranch)))**2
> +
> +         if (ibranch.ne.-ns_channel-1)then
> +            pother(:) = P(:,ibranch+1)
> +            iopposite = ibranch +1
> +         else
> +            pother(:) = p(:,2)
> +            iopposite = abs(tstrategy)
> +         endif
> +         s1  = m(ibranch)**2                        !Total mass available
> +         ma2 = dot(pother, pother)
> +         mb2 = dot(P(0,itree(1,ibranch)),P(0,itree(1,ibranch)))
> +         m12 = m(itree(2,ibranch))**2
> +         mn2 = m(ibranch-1)**2
> +c
> +c$$$         write(*,*) itree(1, ibranch), '-----------T----------', itree(2, ibranch), 'm=', m(itree(2, ibranch))
> +c$$$         write(*,*)        '                       |           '
> +c$$$         write(*,*)   	   '                       |           '
> +c$$$         write(*,*)   	   '                       | ',ibranch
> +c$$$         write(*,*)   	   '                       |           '
> +c$$$         write(*,*)        '                       |           '
> +c$$$         if (ibranch.ne.-ns_channel-1)then
> +c$$$            write(*,*) iopposite, '-----------T---------- m=', m(ibranch-1)
> +c$$$         else
> +c$$$            write(*,*) 2, '-----------T---------- m=', m(ibranch-1)
> +c$$$            write(*,*) m(1), m(2), m(3), m(4), m(5)
> +c$$$         endif
> +c$$$         write(*,*) 'Pa', P(0,itree(1, ibranch)),P(1,itree(1, ibranch)),P(2,itree(1, ibranch)),P(3,itree(1, ibranch))
> +c$$$         if (ibranch.ne.-ns_channel-1) then
> +c$$$            write(*,*) 'Pb', P(0,iopposite),P(1,iopposite),P(2,iopposite), P(3,iopposite)
> +c$$$            do i=0,3
> +c$$$               pother(i) = P(i,itree(1, ibranch)) + P(i,ibranch+1) 
> +c$$$            enddo
> +c$$$         else
> +c$$$            write(*,*) 'Pb', P(0,2),P(1,2),P(2,2),P(3,2)
> +c$$$            do i=0,3
> +c$$$               pother(i) = P(i,1) + P(i,2)
> +c$$$            enddo
> +c$$$         endif
> +c$$$         do i=0,3
> +c$$$            pother(i) = P(i,itree(1, ibranch)) + P(i,iopposite)
> +c$$$         enddo
> +c$$$         write(*,*) 'DSQRT(s1) = ', m(ibranch), DSQRT(dot(pother, pother))
> +c$$$c         if (m(ibranch)**2.ne.dot(pother, pother)) stop 1
> +c$$$         write(*,*) 'm12= Pd**2 = ', m12 ,DSQRT(m12)
> +c$$$         write(*,*) 'mn2 = Pc**2 =', mn2, DSQRT(mn2)
> +         
> +C     WRITE(*,*) 'Enertering yminmax',sqrt(s1),sqrt(m12),sqrt(mn2)
> +         
> +         call yminmax(s1,0d0,m12,ma2,mb2,mn2,tmin,tmax)
> +c         call yminmax(s1,0d0,m12,ma2,mb2,smax,tmin_temp,tmax_temp)
> +c         if (tmin_temp.lt.tmin) tmin = tmin_temp
> +c         if (tmax_temp.gt.tmax) tmax = tmax_temp
> +         
> +c
> +c     Call for 0<x<1
> +c
> +c         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     &        .5d0*(tmin/stot+1d0),
> +c     &        .5d0*(tmax/stot+1d0))
> +c         t   = Stot*(x(-ibranch)*2d0-1d0)
> +c
> +c     call for -1<x<1
> +c
> +
> +c         write(*,*) 'tmin, tmax/ temp',tmin,tmax, tmin_temp, tmax_temp
> +
> +c         if (nt_channel.ge.2)then
> +c            tmin = max(tmin, -stot)
> +c         endif
> +c      if ((tmax-tmin)/stot.gt.0.1)then
> +c            call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $           0d0, 1d0)
> +c         t = stot*(-x(-ibranch))
> +      
> +c      else if (tmax/stot.gt.-0.01.and.tmin/stot.lt.-0.02)then
> +c         set tmax to 0. The idea is to be sure to be able to hit zero
> +c         and not to be block by numerical inacuracy
> +c         tmax = max(tmax,0d0) !This line if want really t freedom
> +c         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $        0d0, -tmin/stot)
> +c         t = stot*(-x(-ibranch))
> +
> +c      else
> +         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +     $        -tmax/stot, -tmin/stot)
> +         t = stot*(-x(-ibranch))
> +c      endif
> +
> +c      call yminmax(s1,0d0,m12,ma2,mb2,mn2,tmin_temp,tmax_temp)
> +      if (t .lt. tmin .or. t .gt. tmax) then
> +         jac=-3d0
> +         return
> +      endif
> +c
> +c     tmin and tmax set to -s,+s for jacobian because part of jacobian
> +c     was determined from choosing the point x from the grid based on
> +c     tmin and tmax.  (ie wgt contains some of the jacobian)
> +c
> +         tmin=-stot
> +         tmax= stot
> +         call sample_get_x(wgt,x(nbranch+(-ibranch-1)*2),
> +     &        nbranch+(-ibranch-1)*2,iconfig,0d0,1d0)
> +         phi = 2d0*pi*x(nbranch+(-ibranch-1)*2)
> +         jac = jac*(tmax-tmin)*2d0*pi /2d0 ! I need /2d0 if -1<x<1
> +
> +         
> +c
> +c     Finally generate the momentum. The call is of the form
> +c     pa+pb -> p1+ p2; t=(pa-p1)**2;   pr = pa-p1
> +c     gentcms(pa,pb,t,phi,m1,m2,p1,pr) 
> +c
> +         if (itree(1,ibranch).gt.-ns_channel-1)then
> +            mi2 = m(itree(1,ibranch))**2
> +         else
> +            mi2 = tmass(itree(1,ibranch))
> +         endif
> +         tmass(ibranch) = t
> +         call gentcms(p(0,itree(1,ibranch)),p(0,iopposite),t,phi,mi2,
> +     &        m(itree(2,ibranch)),m(ibranch-1),p(0,itree(2,ibranch)),
> +     &        p(0,ibranch),jac)
> +c$$$         write(*,*) 'RESULT'
> +c$$$         write(*,*) 'pa', p(0,itree(1,ibranch)),p(1,itree(1,ibranch)),p(2,itree(1,ibranch)),p(3,itree(1,ibranch))
> +c$$$         write(*,*) 'pb', p(0,iopposite),p(1,iopposite),p(2,iopposite),p(3,iopposite)
> +c$$$         write(*,*) '->'
> +c$$$         write(*,*) 'pc', p(0,itree(2,ibranch)),p(1,itree(2,ibranch)),p(2,itree(2,ibranch)),p(3,itree(2,ibranch))
> +c$$$         do i =0,3
> +c$$$            pother(i) = p(i,itree(1,ibranch)) + p(i,iopposite) - p(i,itree(2,ibranch))
> +c$$$         enddo
> +c$$$         write(*,*) 'pc', p(0,itree(2,ibranch)),p(1,itree(2,ibranch)),p(2,itree(2,ibranch)),p(3,itree(2,ibranch))
> +c$$$         write(*,*) 'pd', pother(0), pother(1), pother(2), pother(3) , DSQRT(dot(pother,pother))
> +c$$$         write(*,*) 'T channel'
> +c$$$         write(*,*) 'pr', p(0,ibranch),p(1,ibranch),p(2,ibranch),p(3,ibranch)
> +c$$$         write(*,*) 'pa-pc', p(0,itree(1,ibranch))-p(0,itree(2,ibranch)),p(1,itree(1,ibranch))-p(1,itree(2,ibranch))
> +
> +
> +         
> +         if (jac .lt. 0d0) then
> +c            nerr=nerr+1
> +c            if(nerr.le.5)
> +c     $           write(*,*) 'Failed gentcms',iconfig,ibranch
> +            return              !Failed, probably due to negative x
> +         endif
> +
> +         pswgt = pswgt/(4d0*dsqrt(lambda(s1,ma2,mb2)))
> +      enddo
> +
> +c     
> +c     We need to get the momentum of the last external particle.
> +c     This should just be the sum of p(0,2) and the remaining
> +c     momentum from our last t channel 2->2
> +c
> +      if (nt_channel.eq.1) then
> +c$$$         write(*,*) 'need to assign last', itree(2,-nbranch)
> +c$$$         write(*,*) 'nbranch is at', nbranch
> +c$$$         do i=-nbranch,nexternal
> +c$$$            write(*,*) 'p',i, p(0,i),p(1,i),p(2,i),p(3,i)
> +c$$$         enddo
> +         do i=0,3
> +            p(i,itree(2,-nbranch)) = p(i,-nbranch+1)+p(i,2)
> +         enddo
> +      else
> +c$$$                  write(*,*) 'need to assign last', itree(2,-nbranch)
> +c$$$         write(*,*) 'nbranch is at', nbranch
> +c$$$         do i=-nbranch,nexternal
> +c$$$            write(*,*) 'p',i, p(0,i),p(1,i),p(2,i),p(3,i)
> +c$$$         enddo
> +         do i=0,3
> +            p(i,itree(2,-nbranch)) = p(i,-nbranch+1)+p(i,-nbranch+2)
> +         enddo
> +      endif
> +
> +
> +      else if (tstrategy.eq.2.or.tstrategy.eq.1) then
> +ccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +cc       T-channel One side eat all strategy ending with 2
> +ccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +c
> +c     Now perform the t-channel decay sequence. Most of this comes from: 
> +c     Particle Kinematics Chapter 6 section 3 page 166
> +c
> +c     From here, on we can just pretend this is a 2->2 scattering with
> +c     Pa                    + Pb     -> P1          + P2
> c     p(0,itree(ibranch,1)) + p(0,2) -> p(0,ibranch)+ p(0,itree(ibranch,2))
> c     M(ibranch) is the total mass available (Pa+Pb)^2
> c     M(ibranch-1) is the mass of P2  (all the remaining particles)
> c
>       do ibranch=-ns_channel-1,-nbranch+1,-1
>          s1  = m(ibranch)**2                        !Total mass available
> -         ma2 = m(2)**2
> +         ma2 = m(tstrategy)**2
>          mb2 = dot(P(0,itree(1,ibranch)),P(0,itree(1,ibranch)))
>          m12 = m(itree(2,ibranch))**2
>          mn2 = m(ibranch-1)**2
> c         write(*,*) 'Enertering yminmax',sqrt(s1),sqrt(m12),sqrt(mn2)
>          call yminmax(s1,0d0,m12,ma2,mb2,mn2,tmin,tmax)
> +
> +         if(.false.) then
> +             write(*,*) itree(1, ibranch), 'a----------T----------', itree(2, ibranch), 'm=', m(itree(2, ibranch))
> +             write(*,*)        '                       |           '
> +             write(*,*)   	   '                       |           '
> +             write(*,*)   	   '                       | ',ibranch
> +             write(*,*)   	   '                       |           '
> +             write(*,*)        '                       |           '
> +             write(*,*) tstrategy, '-----------T---------- m=', m(ibranch-1), ibranch-1
> +             write(*,*) 'S', dsqrt(s1), 'm_top=', dsqrt(mb2), 'M_bottom', dsqrt(ma2)
> +             
> +c     write(*,*) m(1), m(2), m(3), m(4), m(5)
> +            write(*,*) 'Pa', P(0,itree(1, ibranch)),P(1,itree(1, ibranch)),P(2,itree(1, ibranch)),P(3,itree(1, ibranch))
> +         endif
> c
> c     Call for 0<x<1
> c
> @@ -859,20 +1090,92 @@
> c
> 
> c         write(*,*) 'tmin, tmax',tmin,tmax
> -
> -      if (tmax.gt.-0.01.and.tmin.lt.-0.02)then
> +         if(.false.) then
> +            ! NOT VALIDATED METHOD, momenta are ok but not jacobian
> +            
> +            call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +     $        0d0, 1d0)
> +            costh= 2d0*x(-ibranch)-1d0
> +            call sample_get_x(wgt,x(nbranch+(-ibranch-1)*2),
> +     &        nbranch+(-ibranch-1)*2,iconfig,0d0,1d0)
> +            phi = 2d0*pi*x(nbranch+(-ibranch-1)*2)
> +            jac = jac * 4d0*pi
> +                     m12 = m(itree(2,ibranch))**2
> +         mn2 = m(ibranch-1)**2
> +         call mom2cx(dsqrt(s1),m(itree(2,ibranch)),m(ibranch-1),costh,phi,
> +     &        p(0,itree(2,ibranch)),pother)
> +
> +         I= itree(2,ibranch)
> +         DO I=0,3
> +            pboost(I) = P(I,tstrategy) + P(I,itree(1, ibranch))
> +         ENDDO
> +         
> +         call boostm(p(0,itree(2,ibranch)),pboost,m(itree(2,ibranch)),p(0,itree(2,ibranch)))
> +         call boostm(pother,pboost,m(ibranch),pother)
> +
> +         do I=0,3
> +            p(I,ibranch) = pother(i) - p(i, tstrategy)
> +         enddo
> +         if(.false.)then
> +         write(*,*) 'input'
> +         write(*,*) 'p(tstrategy=',tstrategy,')', p(0,tstrategy), p(1,tstrategy), p(2,tstrategy), p(3,tstrategy)
> +         I=itree(1, ibranch)
> +         write(*,*) 'p(',I,',)', p(0,i), p(1,i), p(2,i), p(3,i)
> +         write(*,*) 'output'
> +         I= itree(2,ibranch)
> +         write(*,*) 'p(',I,',)', p(0,i), p(1,i), p(2,i), p(3,i)
> +         write(*,*) 'pother', pother(0),pother(1),pother(2),pother(3)
> +         write(*,*) 'check'
> +         do i=0,3
> +            ptemp(i) = p(i,tstrategy) + p(i, itree(1, ibranch))
> +         enddo
> +         write(*,*) 'pa+pb', ptemp(0), ptemp(1), ptemp(2), ptemp(3), dsqrt(dot(ptemp, ptemp))
> +         do i=0,3
> +            ptemp(i) = pother(i) + p(i,itree(2,ibranch))
> +         enddo
> +         write(*,*) 'p1+p2', ptemp(0), ptemp(1), ptemp(2), ptemp(3), dsqrt(dot(ptemp, ptemp))
> +         
> +         write(*,*) 'Tchannel'
> +         I = ibranch
> +         write(*,*) 'p(',I,',)', p(0,i), p(1,i), p(2,i), p(3,i), dot(p(0,I), p(0,I))
> +         endif
> +         
> +         pswgt = pswgt/(4d0*dsqrt(lambda(s1,ma2,mb2)))
> +
> +      else
> +
> +c     test of impact of low t part
> +c         if (nt_channel.ge.2)then
> +c            tmin = max(tmin,  -stot)
> +c         endif
> +
> +
> +         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +     $        -tmax/stot, -tmin/stot)
> +         t = stot*(-x(-ibranch))
> +         
> +
> +c         if ((tmax-tmin)/stot.gt.0.1)then
> +c            call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $           0d0, 1d0)
> +c         t = stot*(-x(-ibranch))
> +c     if (dabs(tmax - tmin)/stot.gt.0.05d0) then
> +c         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $        0d0,  1d0)
> +c     set tmax to 0 and tmin to -1 The idea is to avoid dimension correlation
> +c     the condition ensure a minimum efficiency in the generation of events
> +c         t = stot*(-x(-ibranch))
> +c      else if (tmax.gt.-0.01.and.tmin.lt.-0.02)then
> c         set tmax to 0. The idea is to be sure to be able to hit zero
> c         and not to be block by numerical inacuracy
> -c         tmax = max(tmax,0d0) !This line if want really t freedom
> -         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> -     $        0d0, -tmin/stot)
> -         t = stot*(-x(-ibranch))
> -
> -      else
> -         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> -     $        -tmax/stot, -tmin/stot)
> -         t = stot*(-x(-ibranch))
> -      endif
> +c         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $        0d0, -tmin/stot)
> +c         t = stot*(-x(-ibranch))
> +c      else
> +c         call sample_get_x(wgt,x(-ibranch),-ibranch,iconfig,
> +c     $        -tmax/stot, -tmin/stot)
> +c         t = stot*(-x(-ibranch))
> +c      endif
> 
>          if (t .lt. tmin .or. t .gt. tmax) then
>             jac=-3d0
> @@ -901,7 +1204,7 @@
>             mi2 = tmass(itree(1,ibranch))
>          endif
>          tmass(ibranch) = t
> -         call gentcms(p(0,itree(1,ibranch)),p(0,2),t,phi, mi2,
> +         call gentcms(p(0,itree(1,ibranch)),p(0,tstrategy),t,phi, mi2,
>      &        m(itree(2,ibranch)),m(ibranch-1),p(0,itree(2,ibranch)),
>      &        p(0,ibranch),jac)
> 
> @@ -913,6 +1216,7 @@
>          endif
> 
>          pswgt = pswgt/(4d0*dsqrt(lambda(s1,ma2,mb2)))
> +      endif
>       enddo
> c
> c     We need to get the momentum of the last external particle.
> @@ -920,10 +1224,16 @@
> c     momentum from our last t channel 2->2
> c
>       do i=0,3
> -         p(i,itree(2,-nbranch)) = p(i,-nbranch+1)+p(i,2)
> +         p(i,itree(2,-nbranch)) = p(i,-nbranch+1)+p(i,tstrategy)
>       enddo
> 
> 
> +      
> +      else
> +         write(*,*) 'not supported tstrategy'
> +         stop 2
> +      endif
> +
>       endif                     !t-channel stuff
> 
> 
> @@ -958,6 +1268,18 @@
>          call boostm(p(0,itree(1,i)),p(0,i),m(i),p(0,itree(1,i)))
>          call boostm(p(0,itree(2,i)),p(0,i),m(i),p(0,itree(2,i)))
>       enddo
> +c$$$      write(*,*) '****'
> +c$$$      do i=-nbranch,nexternal
> +c$$$         write(*,*) 'mass', i, m(i)
> +c$$$      enddo
> +c$$$      do i=-nbranch,nexternal
> +c$$$         write(*,*) 'p',i, p(0,i),p(1,i),p(2,i),p(3,i)
> +c$$$      enddo
> +c$$$      do i =0,3
> +c$$$         pother(i) = p(i,1) + p(i,2) - p(i,3) -p(i,4)
> +c$$$      enddo
> +c$$$      write(*,*) 'p5 expected', pother(0), pother(1),pother(2),pother(3)
> +
>       jac = jac*wgt
>       if (.not. pass) jac = -99
>       end
> @@ -1022,7 +1344,7 @@
> c
> c     Arguments
> c
> -      double precision t,phi,m1,m2               !inputs
> +      double precision t,phi,m1,m2,ma               !inputs
>       double precision pa(0:3),pb(0:3),jac
>       double precision p1(0:3),pr(0:3)           !outputs
> c
> @@ -1046,7 +1368,6 @@
>             ptotm(i) = ptot(i)
>          endif
>       enddo
> -c      ma2 = dot(pa,pa)
> c
> c     determine magnitude of p1 in cms frame (from dhelas routine mom2cx)
> c
> @@ -1313,6 +1634,146 @@
>       return
>       end
> 
> -
> +      double precision function get_channel_cut(p, config)
> +      implicit none
> +
> +      include 'maxconfigs.inc'
> +      include 'nexternal.inc'
> +      include 'genps.inc'
> +      include 'maxamps.inc'
> +      include 'coupl.inc'
> +c     include 'run.inc'
> +
> +      double precision p(0:3, nexternal)
> +      integer config
> +      
> +
> +      integer iforest(2,-max_branch:-1,lmaxconfigs)
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/ iforest, tstrategy
> +
> +      integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
> +      integer tprid(-max_branch:-1,lmaxconfigs)
> +      common/to_sprop/sprop,tprid
> +
> +      double precision stot,m1,m2
> +      common/to_stot/stot,m1,m2
> +
> +      double precision tmin_for_channel
> +       integer sde_strat ! 1 means standard single diagram enhancement strategy,
> +c      	      	      	   2 means approximation by the	denominator of the propagator
> +       common/TO_CHANNEL_STRAT/tmin_for_channel,	sde_strat
> +      
> +      integer            mapconfig(0:lmaxconfigs), this_config
> +      common/to_mconfigs/mapconfig, this_config
> +
> +      double precision      spole(maxinvar),swidth(maxinvar),bwjac
> +      common/to_brietwigner/spole          ,swidth          ,bwjac
> +
> +      double precision ptemp(0:3, -nexternal:nexternal)
> +      integer i,j
> +      integer d1, d2
> +      double precision t
> +      double precision dot
> +      external dot
> +      integer ns_channel
> +      integer nb_tchannel
> +      integer nbranch
> +      double precision tmp, tmp2
> +      
> +      double precision ZERO
> +      parameter (ZERO=0d0)
> +      double precision prmass(-nexternal:0,lmaxconfigs)
> +      double precision prwidth(-nexternal:0,lmaxconfigs)
> +      integer pow(-nexternal:0,lmaxconfigs)
> +      logical first_time
> +      save prmass,prwidth,pow
> +      data first_time /.true./
> +
> +      double precision Mass, Width
> +      
> +      include 'configs.inc'
> +
> +      if(sde_strat.eq.1.and.tmin_for_channel.eq.-1)then
> +         get_channel_cut = 1d0
> +         return
> +      endif
> +      
> +      if (first_time) then
> +         include 'props.inc'
> +         first_time=.false.
> +      endif
> +      
> +      do i = 1, nexternal
> +         do j =0,3
> +            ptemp(j,i) = p(j,i)
> +            ptemp(j,-i) = 0d0
> +         enddo
> +      enddo
> +
> +      nbranch = nexternal -2
> +      ns_channel=1
> +      do while((iforest(1,-ns_channel,config) .ne. 1.and.iforest(1,-ns_channel,config) .ne. 2).and.ns_channel.lt.nbranch)
> +         ns_channel=ns_channel+1
> +      enddo
> +      ns_channel=ns_channel - 1
> +      nb_tchannel=nbranch-ns_channel-1
> +c      write(*,*) 'T-channel found: ',nb_tchannel
> +
> +
> +
> +
> +
> +      
> +      get_channel_cut = 1.
> +      if (nb_tchannel.lt.2.and.sde_strat.eq.1)then
> +         get_channel_cut = 1.
> +         return
> +      endif
> +      
> +      do i = 1, nexternal-3
> +         d1 = iforest(1, -i, config)
> +         d2 = iforest(2, -i, config)
> +         do j=0,3
> +            if (d1.gt.0.and.d1.le.2) then
> +               ptemp(j,-i) = ptemp(j,-i) - ptemp(j, d1)
> +            else
> +               ptemp(j,-i) = ptemp(j,-i)+ptemp(j, d1)
> +            endif
> +            if (d2.gt.0.and.d2.le.2) then
> +               ptemp(j,-i) = ptemp(j,-i) - ptemp(j, d2)
> +            else
> +               ptemp(j,-i) = ptemp(j,-i)+ptemp(j, d2)
> +            endif
> +         enddo
> +         if (tprid(-i,config).ne.0)then
> +            if(sde_strat.eq.2)then
> +               t = dot(ptemp(0,-i), ptemp(0,-i))
> +               Mass  = prmass(-i, config)
> +               get_channel_cut = get_channel_cut / ((t-Mass)*(t+Mass))**2
> +            endif
> +c            write(*,*) i, "t, Mass, fact", t, Mass, ((t-Mass)*(t+Mass))**2,get_channel_cut
> +            t = t/stot 
> +            if (t.lt.tmin_for_channel)then
> +                get_channel_cut = get_channel_cut * exp((t-tmin_for_channel)/(t+1))
> +c               get_channel_cut = get_channel_cut * (t+1)/(1+tmin_for_channel)
> +c            else if(t.gt.2*tmin_for_channel)then
> +c               get_channel_cut = get_channel_cut * (2*tmin_for_channel-t)/tmin_for_channel
> +            endif
> +         else
> +            if(sde_strat.eq.2)then
> +               t = dot(ptemp(0,-i), ptemp(0,-i))
> +               Mass  = prmass(-i, config)
> +               Width = prwidth(-i, config)
> +               tmp = (t-Mass)*(t+Mass)
> +               tmp2 = Mass*Width
> +               get_channel_cut = get_channel_cut* (tmp**2 - tmp2**2)/(tmp**2 + tmp2**2)**2 
> +            endif
> +c            write(*,*) i, "s, Mass, Width, fact", t, Mass, Width, (((t-Mass)*(t+Mass) )**2 + Width**2*Mass**2), get_channel_cut
> +         endif
> +      enddo
> +c      write(*,*) 'final for config', config, get_channel_cut
> +      return
> +      end
> 
> 
> 
> === modified file 'Template/LO/SubProcesses/makefile'
> --- Template/LO/SubProcesses/makefile	2017-07-13 10:04:07 +0000
> +++ Template/LO/SubProcesses/makefile	2021-03-24 10:12:56 +0000
> @@ -30,18 +30,27 @@
> 
> # Source files
> 
> +MATRIX_HEL = $(patsubst %.f,%.o,$(wildcard matrix*_orig.f))
> +MATRIX = $(patsubst %.f,%.o,$(wildcard matrix*_optim.f))
> +ifeq ($(strip $(MATRIX_HEL)),)
> +        MATRIX = $(patsubst %.f,%.o,$(wildcard matrix*.f))
> +endif
> +
> +
> PROCESS= driver.o myamp.o genps.o unwgt.o setcuts.o get_color.o \
>          cuts.o cluster.o reweight.o initcluster.o addmothers.o setscales.o \
> 	 idenparts.o dummy_fct.o \
>          $(patsubst %.f,%.o,$(wildcard auto_dsig*.f)) \
> -         $(patsubst %.f,%.o,$(wildcard matrix*.f))
> 
> SYMMETRY = symmetry.o idenparts.o 
> 
> # Binaries
> 
> -$(PROG): $(PROCESS) auto_dsig.o $(LIBS)
> -	$(FC) -o $(PROG) $(PROCESS) $(LINKLIBS) $(LDFLAGS) $(BIASDEPENDENCIES)
> +$(PROG): $(PROCESS) auto_dsig.o $(LIBS) $(MATRIX)
> +	$(FC) -o $(PROG) $(PROCESS) $(MATRIX) $(LINKLIBS) $(LDFLAGS) $(BIASDEPENDENCIES)
> +
> +$(PROG)_forhel: $(PROCESS) auto_dsig.o $(LIBS) $(MATRIX_HEL)
> +	$(FC) -o $(PROG)_forhel $(PROCESS) $(MATRIX_HEL) $(LINKLIBS) $(LDFLAGS) $(BIASDEPENDENCIES)
> 
> gensym: $(SYMMETRY) configs.inc $(LIBDIR)libmodel.$(libext) $(LIBDIR)libgeneric.$(libext)
> 	$(FC) -o gensym $(SYMMETRY) -L../../lib/ -lmodel -lgeneric -lpdf $(llhapdf) $(LDFLAGS)
> @@ -56,6 +65,8 @@
> 	cd ../../Source/PDF; make
> 
> # Add source so that the compiler finds the DiscreteSampler module.
> +$(MATRIX): %.o: %.f
> +	$(FC) $(FFLAGS) $(MATRIX_FLAG) -c $< -I../../Source/
> %.o: %.f
> 	$(FC) $(FFLAGS) -c $< -I../../Source/
> 
> @@ -78,4 +89,4 @@
> initcluster.o: message.inc
> 
> clean:
> -	$(RM) *.o gensym madevent
> +	$(RM) *.o gensym madevent madevent_forhel
> 
> === modified file 'Template/LO/SubProcesses/myamp.f'
> --- Template/LO/SubProcesses/myamp.f	2019-12-04 21:34:25 +0000
> +++ Template/LO/SubProcesses/myamp.f	2021-03-24 10:12:56 +0000
> @@ -38,7 +38,8 @@
> c
>       include 'maxamps.inc'
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest,	tstrategy
>       integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
>       integer tprid(-max_branch:-1,lmaxconfigs)
>       common/to_sprop/sprop,tprid
> @@ -77,7 +78,8 @@
>          include 'props.inc'
>          nbw = 0
>          do i=-1,-(nexternal-3),-1
> -            if (iforest(1,i,iconfig) .eq. 1 .or. prwidth(i,iconfig).le.0) then
> +            if (iforest(1,i,iconfig) .eq. 1 .or. prwidth(i,iconfig).le.0.or.
> +     &                       (nincoming.eq.2.and.iforest(1,i,iconfig) .eq. 2)) then
>               cycle
>             endif
>             nbw=nbw+1
> @@ -110,7 +112,7 @@
> c     Start loop over propagators
>       do i=-1,-(nexternal-3),-1
>          onbw(i) = .false.
> -         if (iforest(1,i,iconfig) .eq. 1) tsgn=-1d0
> +         if (iforest(1,i,iconfig) .eq. 1.or.(nincoming.eq.2.and.iforest(1,i,iconfig).eq.2)) tsgn=-1d0
>          do j=0,3
>             xp(j,i) = xp(j,iforest(1,i,iconfig))
>      $           +tsgn*xp(j,iforest(2,i,iconfig))
> @@ -123,9 +125,12 @@
> c            write(*,*) 'xmass',xmass,prmass(i,iconfig)
> c
> c           Here we set if the BW is "on-shell" for LesHouches
> -c            
> -            prwidth_tmp(i,iconfig) = max(prwidth(i,iconfig), prmass(i,iconfig)*small_width_treatment)
> - 
> +c
> +            if (prwidth(i,iconfig).gt.0) then
> +               prwidth_tmp(i,iconfig) = max(prwidth(i,iconfig), prmass(i,iconfig)*small_width_treatment)
> +            else
> +               prwidth_tmp(i,iconfig) = 0d0
> +            endif
>             onshell = (abs(xmass - prmass(i,iconfig)) .lt.
>      $           bwcutoff*prwidth_tmp(i,iconfig).and.
>      $           (prwidth_tmp(i,iconfig)/prmass(i,iconfig).lt.0.1d0.or.
> @@ -247,7 +252,8 @@
>       common/to_smin/ Smin
> 
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest,	tstrategy
> 
>       integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
>       integer tprid(-max_branch:-1,lmaxconfigs)
> @@ -310,7 +316,11 @@
> c      etmin = 10
>       nt = 0
>       do i = -nexternal,-1
> -         prwidth_tmp(i,iconfig) = max(prwidth(i,iconfig), prmass(i,iconfig)*small_width_treatment)
> +         if (prwidth(i,iconfig) .gt.0d0)then
> +            prwidth_tmp(i,iconfig) = max(prwidth(i,iconfig), prmass(i,iconfig)*small_width_treatment)
> +         else
> +            prwidth_tmp(i,iconfig) = 0d0
> +         endif
>       enddo
> 
> 
> @@ -354,8 +364,10 @@
> 
> c     Start loop over propagators
>       do i=-1,-(nexternal-3),-1
> -         if (iforest(1,i,iconfig) .eq. 1) tsgn=-1d0
> -         if (tsgn .eq. 1d0) then                         !s channel
> +         if (iforest(1,i,iconfig) .eq. 1.or.iforest(1,i,iconfig) .eq. 2)then
> +              tsgn=-1d0
> +         endif
> +         if (tsgn .eq. 1d0) then !s channel
>             xm(i) = xm(iforest(1,i,iconfig))+xm(iforest(2,i,iconfig))
>             xe(i) = xe(iforest(1,i,iconfig))+xe(iforest(2,i,iconfig))
>             mtot = mtot - xm(i)
> 
> === removed file 'Template/LO/SubProcesses/projection.f'
> === modified file 'Template/LO/SubProcesses/reweight.f'
> --- Template/LO/SubProcesses/reweight.f	2020-05-24 20:16:56 +0000
> +++ Template/LO/SubProcesses/reweight.f	2021-03-24 10:12:56 +0000
> @@ -590,6 +590,8 @@
>       common /to_specxpt/xptj,xptb,xpta,xptl,xmtc,xetamin,xqcut,deltaeta
>       double precision stot,m1,m2
>       common/to_stot/stot,m1,m2
> +      logical init_mode
> +      common/to_determine_zero_hel/init_mode
> 
> C   local variables
>       integer i, j, idi, idj, k,m
> @@ -597,6 +599,7 @@
>       real*8 PI
>       parameter( PI = 3.14159265358979323846d0 )
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> +      integer tstrategy
>       double precision asref, pt2prev(n_max_cl),pt2min
>       integer n, ibeam(2), iqcd(0:2)
>       integer idfl, idmap(-nexternal:nexternal)
> @@ -650,11 +653,12 @@
>       endif
>  100  clustered = cluster(p(0,1))
>       if(.not.clustered) then
> +         if(init_mode) goto 999
>          open(unit=26,file='../../../error',status='unknown',err=999)
>          write(26,*) 'Error: Clustering failed in cluster.f.'
>          write(*,*) 'Error: Clustering failed in cluster.f.'
>          stop
> - 999     write(*,*) 'error'
> + 999     write(*,*) 'error for clustering'
>          setclscales=.false.
>          clustered = .false.
>          return
> @@ -1349,6 +1353,7 @@
>       logical setclscales
>       integer mapconfig(0:lmaxconfigs), this_config
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> +      integer tstrategy(lmaxconfigs)
>       integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
>       integer tprid(-max_branch:-1,lmaxconfigs)
>       include 'configs.inc'
> @@ -1738,9 +1743,9 @@
>          if (btest(mlevel,3))
>      $        write(*,*)' set fact scales for PS to ',
>      $        sqrt(q2fact(1)),sqrt(q2fact(2))
> -      else if (abs(lpp(1)).eq.2.or.abs(lpp(1)).eq.3) then
> +      else if (abs(lpp(1)).ge.2.and.abs(lpp(1)).le.4) then
>          q2fact(1)=q2bck(1)
> -      else if (abs(lpp(2)).eq.2.or.abs(lpp(2)).eq.3) then
> +      else if (abs(lpp(2)).ge.2.or.abs(lpp(2)).le.4) then
>          q2fact(2)=q2bck(2)
>       endif
> 
> 
> === modified file 'Template/LO/SubProcesses/setcuts.f'
> --- Template/LO/SubProcesses/setcuts.f	2019-06-17 14:27:09 +0000
> +++ Template/LO/SubProcesses/setcuts.f	2021-03-24 10:12:56 +0000
> @@ -879,7 +879,8 @@
>       double precision pmass(nexternal)
>       common/to_mass/  pmass
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest,	tstrategy
>       integer mapconfig(0:lmaxconfigs), this_config
>       common/to_mconfigs/mapconfig, this_config
> 
> @@ -946,7 +947,8 @@
> c     Global
> c
>       integer iforest(2,-max_branch:-1,lmaxconfigs)
> -      common/to_forest/ iforest
> +      integer tstrategy(lmaxconfigs)
> +      common/to_forest/iforest,	tstrategy
>       integer sprop(maxsproc,-max_branch:-1,lmaxconfigs)
>       integer tprid(-max_branch:-1,lmaxconfigs)
>       common/to_sprop/sprop,tprid
> 
> === modified file 'Template/LO/SubProcesses/setscales.f'
> --- Template/LO/SubProcesses/setscales.f	2020-03-08 20:49:57 +0000
> +++ Template/LO/SubProcesses/setscales.f	2021-03-24 10:12:56 +0000
> @@ -24,6 +24,7 @@
>       double precision pmass(nexternal)
>       common/to_mass/  pmass
> 
> +      
>       real*8 xptj,xptb,xpta,xptl,xmtc
>       real*8 xetamin,xqcut,deltaeta
>       common /to_specxpt/xptj,xptb,xpta,xptl,xmtc,xetamin,xqcut,deltaeta
> @@ -69,8 +70,8 @@
>           enddo
>           rscale=rscale/2d0
>       elseif(dynamical_scale_choice.eq.4) then
> -c         \sqrt(s), partonic energy
> -          rscale=dsqrt(max(0d0,2d0*dot(P(0,1),P(0,2))))
> +c     \sqrt(s), partonic energy
> +         rscale = dsqrt(max(0d0,sumdot(p(0,1), p(0,2), 1d0)))
>       elseif(dynamical_scale_choice.eq.5) then
> c         \decaying particle mass, for decays
>           rscale=dsqrt(max(0d0,dot(P(0,1),P(0,1))))
> 
> === removed file 'Template/LO/SubProcesses/shrinktops.f'
> === removed file 'Template/LO/SubProcesses/transform.f'
> === removed file 'Template/LO/SubProcesses/transformint.f'
> === modified file 'Template/LO/SubProcesses/unwgt.f'
> --- Template/LO/SubProcesses/unwgt.f	2020-05-20 11:52:45 +0000
> +++ Template/LO/SubProcesses/unwgt.f	2021-03-24 10:12:56 +0000
> @@ -145,11 +145,19 @@
> C     compute the boost for the requested transformation
>       implicit none
>       double precision pin(0:3), pout(0:3)
> -      double precision denom
> +      double precision denom, control
> 
>       denom = pin(0)*pout(0) - pin(3)*pout(3)
>       if (denom.ne.0d0) then
> -         get_betaz = (pin(3) * pout(0) - pout(3) * pin(0)) / denom
> +         control = pin(0)*pout(0) + pin(3)*pout(3)
> +         if (denom/control.gt.1d-12)then
> +            get_betaz = (pin(3) * pout(0) - pout(3) * pin(0)) / denom
> +c        pass in massless case
> +         else if (abs(pin(0)+pin(3)).gt.abs(pin(0))) then
> +            get_betaz = (pin(0)**2 - pout(0)**2)/(pin(0)**2 + pout(0)**2)
> +         else
> +            get_betaz = (pout(0)**2 - pin(0)**2)/(pin(0)**2 + pout(0)**2)
> +         endif
>       else if (pin(0).eq.pin(3)) then
>          get_betaz = (pin(0)**2 - pout(0)**2)/(pin(0)**2 + pout(0)**2)
>       else if (pin(0).eq.abs(pin(3))) then
> @@ -460,6 +468,8 @@
>       include 'run.inc'
>       include 'run_config.inc'
> 
> +
> +      
> c
> c     Arguments
> c
> @@ -496,6 +506,9 @@
> C     
> C     GLOBAL
> C
> +      logical init_mode
> +      common/to_determine_zero_hel/init_mode
> +      
>       double precision twgt, maxwgt,swgt(maxevents)
>       integer                             lun, nw, itmin
>       common/to_unwgt/twgt, maxwgt, swgt, lun, nw, itmin
> @@ -543,7 +556,7 @@
> C-----
> 
>       if ((nw .ge. maxevents).and.do_write_events) return
> -
> +      if (init_mode) return
> C     if all the necessary inputs to write the events have already been
> C     computed in the bias module, then directly jump to write_events
>       if (AlreadySetInBiasModule) then
> 
> === modified file 'Template/LO/bin/generate_events'
> --- Template/LO/bin/generate_events	2018-03-19 21:56:39 +0000
> +++ Template/LO/bin/generate_events	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> ################################################################################
> #
> # Copyright (c) 2011 The MadGraph5_aMC@NLO Development team and Contributors
> @@ -27,10 +27,17 @@
> root_path = os.path.split(os.path.dirname(os.path.realpath( __file__ )))[0]
> pjoin = os.path.join
> 
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadEvent works with python 2.6 or higher (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadEvent works with python 2.7/3.7 or higher.\n\
>                Please upgrade your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> +    
> # Check if optimize mode is (and should be) activated
> if __debug__ and (not os.path.exists(pjoin(root_path,'../..', 'bin','create_release.py'))):
>     subprocess.call([sys.executable] + ['-O'] + sys.argv)
> @@ -50,7 +57,7 @@
>     try:
>         import pyreadline as readline
>     except:
> -        print "For tab completion and history, install module readline."
> +        print("For tab completion and history, install module readline.")
> else:
>     import rlcompleter
> 
> @@ -81,7 +88,7 @@
>    pass
> 
> if __debug__:
> -        print 'Running MG5 in debug mode'
> +        print('Running MG5 in debug mode')
> 
> 
> 
> @@ -99,25 +106,25 @@
>     try:
>         mode = int(argument[1])
>     except:
> -        mode = int(raw_input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
> +        mode = int(six.moves.input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
>     if mode == 0:
>         try:
>             name = argument[2]
>         except:
> -            name = raw_input('Enter run name\n')
> +            name = six.moves.input('Enter run name\n')
>     else:
>         try:
>             opt = argument[2]
>         except:
>             if mode == 1: 
> -                opt = raw_input('Enter name for jobs on pbs queue\n')
> +                opt = six.moves.input('Enter name for jobs on pbs queue\n')
>             else:
> -                opt = int(raw_input('Enter number of cores\n'))
> +                opt = int(six.moves.input('Enter number of cores\n'))
> 
>         try:
>             name = argument[3]
>         except:
> -            name = raw_input('enter run name\n')
> +            name = six.moves.input('enter run name\n')
> 
> #    launch = ME.MadEventCmd(me_dir=root_path)
> 
> @@ -158,7 +165,7 @@
>             launch = ME.MadEventCmdShell(me_dir=root_path, force_run=True)
>             launch.run_cmd('generate_events %s' % ' '.join(argument[1:]))
>             launch.run_cmd('quit')
> -    except ME.MadEventAlreadyRunning, message:
> +    except ME.MadEventAlreadyRunning as message:
>         logging.getLogger('madgraph').log(40, str(message))
>         sys.exit(1)
>     except KeyboardInterrupt:
> @@ -166,7 +173,7 @@
>             launch.run_cmd('quit')
>         except:
>             pass
> -    except Exception, error:
> +    except Exception as error:
>         logging.error(str(error))
>         sys.exit()
> 
> 
> === modified file 'Template/LO/bin/internal/Gridpack/gridrun'
> --- Template/LO/bin/internal/Gridpack/gridrun	2017-06-08 18:43:40 +0000
> +++ Template/LO/bin/internal/Gridpack/gridrun	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> 
> ################################################################################
> #
> @@ -18,11 +18,20 @@
> """This is the main executable, a simple frontend to set up the PYTHONPATH
> and call immediately the command line interface scripts"""
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import sys
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadGraph/MadEvent 5 works only with python 2.6 or later (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadGraph/MadEvent 5 works only with python 2.7/3.7 or later.\n\
>                Please upgrate your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> +    
> import os
> import optparse
> 
> @@ -62,7 +71,7 @@
>    pass
> 
> if __debug__:
> -        print 'Running MG5 in debug mode'
> +        print('Running MG5 in debug mode')
> 
> 
> # Set logging level according to the logging level given by options
> @@ -81,13 +90,12 @@
> # Call the cmd interface main loop
> 
> 
> -
> try:
>     cmd_line = cmd_interface.GridPackCmd(me_dir=root_path, nb_event=args[0], seed=args[1], gran=args[2])            
> except KeyboardInterrupt:
> -    print 'Quit on KeyboardInterrupt' 
> +    print('Quit on KeyboardInterrupt') 
> 
> -print 'DONE'
> +print('DONE')
> 
> try:
>     # Remove lock file
> 
> === modified file 'Template/LO/bin/internal/addmasses_optional.py'
> --- Template/LO/bin/internal/addmasses_optional.py	2015-10-15 20:22:39 +0000
> +++ Template/LO/bin/internal/addmasses_optional.py	2021-03-24 10:12:56 +0000
> @@ -5,8 +5,11 @@
> # Add masses to charged leptons, fix kinematics
> # Insert W/Z when missing
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import math,sys,re
> from xml.dom import minidom
> +from six.moves import range
> 
> #tolerance for energy momentum conservation
> toler = 1e-4
> @@ -70,7 +73,7 @@
>         self.pz = self.pz/pi*po
>     def printMe(self):
>         li = [self.px,self.py, self.pz, self.E, self.m]
> -        print "| %18.10E %18.10E %18.10E %18.10E %18.10E |" % tuple(li)    
> +        print("| %18.10E %18.10E %18.10E %18.10E %18.10E |" % tuple(li))    
> 
> #useful class to describe a particle
> class Particle:
> @@ -87,7 +90,7 @@
>         self.polar = l[12]
>     def printMe(self):
>         li = [self.no, self.id, self.status,self.mo1, self.mo2, self.co1, self.co2, self.mom.px,self.mom.py, self.mom.pz, self.mom.E, self.mom.m, self.life, self.polar]
> -        print "%2i | %9i | %4i | %4i %4i | %4i %4i | %18.10E %18.10E %18.10E %18.10E %18.10E | %1.0f. %2.0f" % tuple(li)
> +        print("%2i | %9i | %4i | %4i %4i | %4i %4i | %18.10E %18.10E %18.10E %18.10E %18.10E | %1.0f. %2.0f" % tuple(li))
>     def writeMe(self):
>         li = [self.id, self.status,self.mo1, self.mo2, self.co1, self.co2, self.mom.px,self.mom.py, self.mom.pz, self.mom.E, self.mom.m, self.life, self.polar]
>         return "%9i %4i %4i %4i %4i %4i %18.10E %18.10E %18.10E %18.10E %18.10E  %1.0f. %2.0f\n" % tuple(li)        
> @@ -108,7 +111,7 @@
>         try:
>             line=f.readline()
>         except IOError:
> -            print "Problem reading from file ",sys.argv[1]
> +            print("Problem reading from file ",sys.argv[1])
>             sys.exit(0)
>         if line.find("<event>")==-1:
>             g.write(line)
> @@ -121,7 +124,7 @@
>     try:
>         xmldoc = minidom.parse(sys.argv[1])
>     except IOError:
> -        print " could not open file for xml parsing ",sys.argv[1]
> +        print(" could not open file for xml parsing ",sys.argv[1])
>         sys.exit(0)
> 
> 
> @@ -178,7 +181,7 @@
>             if len(noMotherList)==0:
>                 pass
>             elif len(noMotherList)%2 != 0:
> -                print "single orphan; do not know how to process"
> +                print("single orphan; do not know how to process")
>             else:
>                 ki=0
>                 while ki<len(noMotherList)-1:
> @@ -265,7 +268,7 @@
>                 pSum = pSum + p.mom
> 
>         if abs(pSum.px)>toler or abs(pSum.py)>toler or abs(pSum.pz)>toler or abs(pSum.E)>toler:
> -            print "Event does not pass tolerance ",toler
> +            print("Event does not pass tolerance ",toler)
>             pSum.printMe()
> 
>         if 1:
> @@ -286,28 +289,28 @@
> 
>     #main part of analysis
>     if len(sys.argv)!=3:
> -        print "Usage: addmasses.py <infile> <outfile>    "
> -        print " Last modified: Fri Nov 21 10:49:14 CST 2008 "
> +        print("Usage: addmasses.py <infile> <outfile>    ")
> +        print(" Last modified: Fri Nov 21 10:49:14 CST 2008 ")
>         sys.exit(1)
>     else:
> -        print "Running addmasses.py to add masses and correct kinematics of fixed particles"
> +        print("Running addmasses.py to add masses and correct kinematics of fixed particles")
> 
>     #first print out leading information
>     try:
>         f=open(sys.argv[1],'r')
>     except IOError:
> -        print "need a file for reading"
> +        print("need a file for reading")
>         sys.exit(1)
> 
>     try:
>         g=open(sys.argv[2],'w')
>     except IOError:
> -        print "need a file for writing"
> +        print("need a file for writing")
>         sys.exit(1)
> 
>     try:
>         add_masses(f,g)
> -    except Exception, error:
> -        print "addmasses failed with error, %s" % error
> +    except Exception as error:
> +        print("addmasses failed with error, %s" % error)
>         sys.exit(1)
> 
> 
> === modified file 'Template/LO/bin/madevent'
> --- Template/LO/bin/madevent	2018-03-30 07:54:37 +0000
> +++ Template/LO/bin/madevent	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> 
> ################################################################################
> #
> @@ -19,10 +19,18 @@
> and call immediately the command line interface scripts"""
> 
> import sys
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadGraph/MadEvent 5 works only with python 2.6 or later (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadGraph/MadEvent 5 works only with python 2.7/3.7 or later.\n\
>                Please upgrate your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> +
> +    
> import os
> import optparse
> 
> @@ -59,7 +67,7 @@
>     try:
>         (options, args) = parser.parse_args(sys.argv[1:len(sys.argv)-i])
>         done = True
> -    except MyOptParser.InvalidOption, error:
> +    except MyOptParser.InvalidOption as error:
>         pass 
>     else:
>         args += sys.argv[len(sys.argv)-i:]
> @@ -67,8 +75,8 @@
>     # raise correct error:
>     try:
>         (options, args) = parser.parse_args()
> -    except MyOptParser.InvalidOption, error:
> -        print error
> +    except MyOptParser.InvalidOption as error:
> +        print(error)
>         sys.exit(2)  
> 
> if len(args) == 0:
> @@ -79,7 +87,7 @@
> # Check if optimize mode is (and should be) activated
> if __debug__ and not options.debug and \
>     (not os.path.exists(os.path.join(root_path,'../..', 'bin','create_release.py')) or options.web):
> -        print 'launch in debug mode'
> +        print( 'launch in debug mode')
>         subprocess.call([sys.executable] + ['-O'] + sys.argv)
>         sys.exit()
> 
> @@ -92,7 +100,7 @@
>     try:
>         import pyreadline as readline
>     except:
> -        print "For tab completion and history, install module readline."
> +        print( "For tab completion and history, install module readline.")
> else:
>     import rlcompleter
> 
> @@ -123,7 +131,7 @@
>    pass
> 
> if __debug__:
> -        print 'Running MG5 in debug mode'
> +        print( 'Running MG5 in debug mode')
> 
> 
> # Set logging level according to the logging level given by options
> @@ -175,10 +183,10 @@
>                 cmd_line = cmd_interface.MadEventCmdShell(force_run=True)
>             if not hasattr(cmd_line, 'do_%s' % args[0]):
>                 if parser_error:
> -                    print parser_error
> -                    print 'and %s  can not be interpreted as a valid command.' % args[0]
> +                    print( parser_error)
> +                    print( 'and %s  can not be interpreted as a valid command.' % args[0])
>                 else:
> -                    print 'ERROR: %s  not a valid command. Please retry' % args[0]
> +                    print( 'ERROR: %s  not a valid command. Please retry' % args[0])
>             else:
>                 cmd_line.use_rawinput = False    
>                 cmd_line.run_cmd(' '.join(args))
> @@ -192,9 +200,9 @@
>                 cmd_line = cmd_interface.MadEventCmdShell(force_run=True)
>                 cmd_line.cmdloop()
> except KeyboardInterrupt:
> -    print 'writting history and directory and quit on KeyboardInterrupt' 
> +    print( 'writting history and directory and quit on KeyboardInterrupt' )
>     pass
> -except cmd_interface.MadEventAlreadyRunning, error:
> +except cmd_interface.MadEventAlreadyRunning  as  error:
>     logging.error(str(error))
>     sys.exit(1)
> 
> 
> === modified file 'Template/MadWeight/Python/Info.py'
> --- Template/MadWeight/Python/Info.py	2015-10-01 16:00:08 +0000
> +++ Template/MadWeight/Python/Info.py	2021-03-24 10:12:56 +0000
> @@ -1,18 +1,21 @@
> -#!/usr/bin/env python
> -
> -def giveInfo(class_):
> -        if type(class_)!=str:
> -                class_=class_.__class__.__name__
> -        for info in dir(eval(class_)):
> -                
> -                print class_+'.'+info+' : ',eval(class_+'.'+info+'.__doc__')
> -
> -
> -
> -if __name__=='__main__':
> -    class_=raw_input('enter the name of the class')
> -    try:
> -        import class_
> -    except:
> -        pass
> -    giveInfo(class_)
> +#!/usr/bin/env python
> +
> +from __future__ import absolute_import
> +from __future__ import print_function
> +from six.moves import input
> +def giveInfo(class_):
> +        if type(class_)!=str:
> +                class_=class_.__class__.__name__
> +        for info in dir(eval(class_)):
> +                
> +                print(class_+'.'+info+' : ',eval(class_+'.'+info+'.__doc__'))
> +
> +
> +
> +if __name__=='__main__':
> +    class_=input('enter the name of the class')
> +    try:
> +        import class_
> +    except:
> +        pass
> +    giveInfo(class_)
> 
> === modified file 'Template/MadWeight/Python/clean.py'
> --- Template/MadWeight/Python/clean.py	2015-10-01 16:00:08 +0000
> +++ Template/MadWeight/Python/clean.py	2021-03-24 10:12:56 +0000
> @@ -33,6 +33,8 @@
> ##
> ## BEGIN INCLUDE
> ##
> +from __future__ import absolute_import
> +from __future__ import print_function
> import os
> 
> #1 #########################################################################
> @@ -48,8 +50,8 @@
>         if os.path.isdir(element) and (element[0]=='P' or element[:4]=='MW_P'):
>             status,mess=clean.suppress_dir(os.path.join(element,run_name))
>             if not status:
> -                print 'supress ',element,' failed:' 
> -                print mess
> +                print('supress ',element,' failed:') 
> +                print(mess)
> 
>     os.chdir(os.pardir)
> 
> @@ -161,14 +163,14 @@
> 
>         if suppres and os.path.isfile(file):
>             if 'n' in opt:
> -                print 'schedulle deleting file',file
> +                print('schedulle deleting file',file)
>                 return 1,mess
>             try:
>                 os.remove(file)
>             except:
>                 pass
>             if 's' not in opt:
> -                print 'delete file',file
> +                print('delete file',file)
>             return 1,''
>         elif suppres:
>             return 0, 'not a file'+file
> @@ -221,9 +223,9 @@
>             if 'n' not in opt:
>                 os.rmdir(pos)
>                 if 's' not in opt:
> -                    print 'delete dir',pos
> +                    print('delete dir',pos)
>             else:
> -                print 'schedulle removing directory',pos
> +                print('schedulle removing directory',pos)
> 
>             return 1,''
>         else:
> @@ -237,4 +239,4 @@
>     go_to_main_dir()
>     #Clean_event('fermi')
>     #Clean_run('fermi')
> -    print 'no cleaning by default'
> +    print('no cleaning by default')
> 
> === modified file 'Template/MadWeight/Python/expand_MadWeight.py'
> --- Template/MadWeight/Python/expand_MadWeight.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/Python/expand_MadWeight.py	2021-03-24 10:12:56 +0000
> @@ -1,6 +1,8 @@
> #!/usr/bin/env python
> 
> # Module
> +from __future__ import absolute_import
> +from __future__ import print_function
> import string
> import os
> import sys
> @@ -11,10 +13,10 @@
> 
> def expand_all(echap=[]):
>     go_to_main_dir()
> -    print "copying files"
> +    print("copying files")
>     copy_file(echap)
>     del_file()
> -    print "modifying files"
> +    print("modifying files")
>     opt={}
>     opt['nowarning']="""['DESACTIVATE_CUT','DESACTIVATE_BW_CUT','get_user_params','main_make','obj_for_MW']"""
>     mod_file.mod_file('./Source/MadWeight/mod_file/MW_pos',opt=opt)
> 
> === modified file 'Template/MadWeight/Python/madweight.py'
> --- Template/MadWeight/Python/madweight.py	2013-03-29 20:38:55 +0000
> +++ Template/MadWeight/Python/madweight.py	2021-03-24 10:12:56 +0000
> @@ -6,12 +6,15 @@
> 
> 
> #Extension
> +from __future__ import absolute_import
> +from __future__ import print_function
> import string
> import sys
> import os
> import re
> import time
> import stat
> +from six.moves import input
> # patch if symbolic directory replace by real file
> sys.path.append('./Source/MadWeight/Python')
> sys.path.append('../Source/MadWeight/Python')
> @@ -37,7 +40,7 @@
> def Launch_all_SubProcess(MWparam):
> 
>     name=MWparam.name
> -    print 'name :',name
> +    print('name :',name)
>     P_proclist,MW_proclist=MWparam.P_listdir,MWparam.MW_listdir
>     #create banner
>     if MWparam.run_opt['launch']:
> @@ -46,14 +49,14 @@
>         banner.write()
> 
>     if MWparam.run_opt['compilation']:
> -        print 'starting program compilation'
> +        print('starting program compilation')
>         compile_SubProcesses(MW_proclist)
> 
>     if MWparam.run_opt['event']:
>         verif_event(MWparam)
> 
>     if MWparam.run_opt['refine']:
> -        print "collecting data to find data with a precision less than",MWparam.run_opt['refine']
> +        print("collecting data to find data with a precision less than",MWparam.run_opt['refine'])
>         collect_schedular(MWparam)          
> 
> 
> @@ -62,7 +65,7 @@
>     cluster.driver()
> 
>     if MWparam.run_opt['collect']:
> -        print "collecting data"
> +        print("collecting data")
>         collect_schedular(MWparam)          
> 
> 
> @@ -90,7 +93,7 @@
>         if  os.path.isfile("./comp_madweight") and exit_status==0 :
>             os.chdir("..")
>         else:
> -            print "fortran compilation error"
> +            print("fortran compilation error")
>             sys.exit()
>     os.chdir("..")   
>     return
> @@ -109,7 +112,7 @@
>         if  os.path.isfile("./madevent") and exit_status==0:
>             os.chdir("..")
>         else:
> -            print "fortran compilation error"
> +            print("fortran compilation error")
>             sys.exit()
>     os.chdir("..")   
>     return  
> @@ -142,15 +145,15 @@
> 
>     for dir in MWparam.MW_listdir:
>       if not os.path.exists("SubProcesses/"+dir+"/call_TF.f"): 
> -        print "Currently no transfer function loaded ..."
> +        print("Currently no transfer function loaded ...")
>         listdir=os.listdir('./Source/MadWeight/transfer_function/data')
> -        print 'Available transfer functions:\n   ',
> -        print '\n    '.join([content[3:-4] for content in listdir if (content.startswith('TF') and content.endswith('dat'))])
> -        name=raw_input('Choose your transfer Function\n')
> +        print('Available transfer functions:\n   ', end=' ')
> +        print('\n    '.join([content[3:-4] for content in listdir if (content.startswith('TF') and content.endswith('dat'))]))
> +        name=input('Choose your transfer Function\n')
>         P_dir,MW_dir=detect_SubProcess(P_mode=1)
>         os.chdir('./Source/MadWeight/transfer_function')
>         change_tf.create_TF_main(name,0,MW_dir)
> -        print os.getcwd()
> +        print(os.getcwd())
>         os.chdir('../../..')
>         break
> 
> @@ -173,7 +176,7 @@
>             plot.Differential_Graph(MWparam,auto=1)        
> 
>     if MWparam.run_opt['clean']:
> -        print 'cleaning in progress ....'
> +        print('cleaning in progress ....')
>         from clean import Clean_run
>         if MWparam.run_opt['clean']==1:
>             Clean_run(MWparam.name)
> 
> === modified file 'Template/MadWeight/Python/put_banner.py'
> --- Template/MadWeight/Python/put_banner.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/Python/put_banner.py	2021-03-24 10:12:56 +0000
> @@ -99,7 +99,11 @@
> 
> 
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import os,re,sys
> +from six.moves import range
> +from six.moves import input
> sys.path+=['../'*i+'./Source/MadWeight/Python' for i in range(1,6)]
> import MW_param
> 
> @@ -140,7 +144,7 @@
>         """    |   put in variable full_banner_txt the content of the file      ##
>         ##     |   defined in position self.header_file                         ##
>         """
> -        self.full_banner_txt+=file(self.header_file,'rU').read()
> +        self.full_banner_txt+=open(self.header_file,'rU').read()
> 
>     #2 #######################################################################
>     def put_version_info(self):
> @@ -149,7 +153,7 @@
>         self.full_banner_txt+="<MGVersion>\n"
>         for key,pos in self.version_info.items():
>             try:
> -                self.full_banner_txt+="# "+key+' '*(25-len(key))+':'+file(pos,'rU').read()
> +                self.full_banner_txt+="# "+key+' '*(25-len(key))+':'+open(pos,'rU').read()
>             except IOError:
>                 self.full_banner_txt+="# "+key+' '*(25-len(key))+':'
>             if self.full_banner_txt[-1]!='\n':
> @@ -170,7 +174,7 @@
>             try:
>                 self.full_banner_txt+=eval('self.mod_'+key+'(\"'+pos+'\")')
>             except:
> -                self.full_banner_txt+=file(pos,'rU').read()
> +                self.full_banner_txt+=open(pos,'rU').read()
>             self.full_banner_txt+="</"+key+">\n"
> 
>     #2 #######################################################################
> @@ -179,7 +183,7 @@
>         ##     |   self.input_file                                              ##
>         """
> 
> -        self.full_banner_txt+=file(self.input_file,'rU').read()
> +        self.full_banner_txt+=open(self.input_file,'rU').read()
>         if self.full_banner_txt[-1]!='\n':
>             self.full_banner_txt+='\n'
>         self.full_banner_txt+="</LesHouchesEvents>\n"
> @@ -192,7 +196,7 @@
>         """
>         suppress_empty_line=re.compile(r'''\n\s*\n''')
>         self.full_banner_txt=suppress_empty_line.sub('\n',self.full_banner_txt)
> -        output=file(self.output_file,'w')
> +        output=open(self.output_file,'w')
>         output.writelines(self.full_banner_txt)
>         output.close()
> 
> @@ -255,11 +259,11 @@
>         ##     |   modify (or original) run_card.dat                            ##
>         """
> 
> -        text=file(inputfile).read()
> +        text=open(inputfile).read()
>         if os.path.isfile('./SubProcesses/randinit'):
>             pattern_random=re.compile(r'''r=\s*(?P<val>\d*)''')
> -            print file('./SubProcesses/randinit').read()
> -            seed=pattern_random.search(file('./SubProcesses/randinit').read()).group('val')
> +            print(open('./SubProcesses/randinit').read())
> +            seed=pattern_random.search(open('./SubProcesses/randinit').read()).group('val')
>             pattern_seed=re.compile(r'''0\s*=\s*iseed''')
>             text=pattern_seed.sub(' '+seed+' = iseed',text)#
> 
> @@ -306,7 +310,7 @@
>     def_pos.to_main()
>     opt=sys.argv
>     if len(opt)==1:
> -        filename=raw_input('Enter file with events (in directory Events)')
> +        filename=input('Enter file with events (in directory Events)')
>     else:
>         filename=opt[1]
> 
> 
> === modified file 'Template/MadWeight/Python/splitbanner.py'
> --- Template/MadWeight/Python/splitbanner.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/Python/splitbanner.py	2021-03-24 10:12:56 +0000
> @@ -14,7 +14,10 @@
> ##   last-modif:24/01/09                                                ##
> ##                                                                      ##
> ##########################################################################
> +from __future__ import absolute_import
> +from __future__ import print_function
> import sys
> +from six.moves import input
> # patch if symbolic directory replace by real file
> sys.path.append('./Source/MadWeight/Python')
> sys.path.append('../Source/MadWeight/Python')
> @@ -52,7 +55,7 @@
> 
>     def write_card(self,pos):
> 
> -        print 'writing', pos
> +        print('writing', pos)
>         ff=open(pos,'w')
>         for line in self.file:
>             if self.pat_end.search(line):
> @@ -62,7 +65,7 @@
>                 ff.writelines(line)
> 
>     def FindCardName(self,tag):
> -        if tag in dico.keys():
> +        if tag in list(dico.keys()):
>             if '.' not in dico[tag]:
>                 return dico[tag]+'.dat'
>             else:
> @@ -77,9 +80,9 @@
>     import MW_param
>     MW_param.go_to_main_dir()
>     opt=sys.argv
> -    print opt
> +    print(opt)
>     if len(opt)<2:
> -       name=raw_input('enter the run name to restore or the position of a banner file\n')
> +       name=input('enter the run name to restore or the position of a banner file\n')
>     else:
>         name=opt[1]
> 
> @@ -91,15 +94,15 @@
>         pos='/'.join([part for part in name.split('/')[:-1]])
> 
>     ban.split()
> -    print 'done'
> +    print('done')
> 
>     if len(opt)==3:
>         import_lhco=opt[2]
>     else:
> -        import_lhco=raw_input('Do you want import the input.lhco file? (1/0)\n')
> +        import_lhco=input('Do you want import the input.lhco file? (1/0)\n')
> 
> 
>     if int(import_lhco):
>         os.system('cp '+pos+'/input.lhco ./Events')
> -        print 'replace Events/input.lhco by '+pos+'/input.lhco'
> +        print('replace Events/input.lhco by '+pos+'/input.lhco')
> 
> 
> === modified file 'Template/MadWeight/Python/tests.py'
> --- Template/MadWeight/Python/tests.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/Python/tests.py	2021-03-24 10:12:56 +0000
> @@ -20,7 +20,10 @@
> #########################################################################################################
> #  TEST #################################################################################################
> #########################################################################################################
> +from __future__ import absolute_import
> +from __future__ import print_function
> import sys
> +from six.moves import input
> sys.path.append('./Source/MadWeight/Python')
> import filecmp
> import unittest
> @@ -279,10 +282,10 @@
> 
> 
> 
> -print 'WARNING: This test modify this version of the Template. The correct way to launch it is to first made a copy of the Template'
> -y =raw_input('Do you want to continue? [y/n]')
> +print('WARNING: This test modify this version of the Template. The correct way to launch it is to first made a copy of the Template')
> +y =input('Do you want to continue? [y/n]')
> if y == 'y':
>     unittest.main()
> else:
> -    print 'stopped'
> +    print('stopped')
> 
> 
> === modified file 'Template/MadWeight/bin/madweight.py'
> --- Template/MadWeight/bin/madweight.py	2013-03-30 07:45:35 +0000
> +++ Template/MadWeight/bin/madweight.py	2021-03-24 10:12:56 +0000
> @@ -15,6 +15,8 @@
> ################################################################################
> """ This is the main script in order to generate events in MadEvent """
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import sys
> import os
> import subprocess 
> @@ -33,7 +35,7 @@
> 
> # Check if optimize mode is (and should be) activated
> if __debug__ and (not os.path.exists(os.path.join(root_path,'../..', 'bin','create_release.py'))):
> -    print 'launch in debug mode'
> +    print('launch in debug mode')
>     subprocess.call([sys.executable] + ['-O'] + sys.argv)
>     sys.exit()
> 
> @@ -50,7 +52,7 @@
>     try:
>         import pyreadline as readline
>     except:
> -        print "For tab completion and history, install module readline."
> +        print("For tab completion and history, install module readline.")
> else:
>     import rlcompleter
> 
> @@ -81,7 +83,7 @@
>    pass
> 
> if __debug__:
> -        print 'Running MG5 in debug mode'
> +        print('Running MG5 in debug mode')
> 
> 
> def set_configuration():
> @@ -163,10 +165,10 @@
>             launch.run_cmd('quit')
>         except:
>             pass
> -    except MW.AlreadyRunning, error:
> +    except MW.AlreadyRunning as error:
>         logging.error(str(error))
>         sys.exit()
> -    except Exception, error:
> +    except Exception as error:
>         if os.path.exists(pjoin(root_path, 'RunWeb')): 
>             os.remove(pjoin(root_path, 'RunWeb'))
>         raise 
> 
> === modified file 'Template/MadWeight/mod_file/check_model.py'
> --- Template/MadWeight/mod_file/check_model.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/mod_file/check_model.py	2021-03-24 10:12:56 +0000
> @@ -3,6 +3,8 @@
> #test
> 
> #Extension
> +from __future__ import absolute_import
> +from __future__ import print_function
> import string
> import os
> import sys
> @@ -29,7 +31,7 @@
>     if 'bin' in list_dir:
>         return
>     else:
> -        print 'script must be launched from main or bin/Source directory'
> +        print('script must be launched from main or bin/Source directory')
>         sys.exit()
> 
> 
> 
> === modified file 'Template/MadWeight/mod_file/mod_file.py'
> --- Template/MadWeight/mod_file/mod_file.py	2011-10-25 14:42:02 +0000
> +++ Template/MadWeight/mod_file/mod_file.py	2021-03-24 10:12:56 +0000
> @@ -1,11 +1,14 @@
> #!/usr/bin/env python
> 
> #Extension
> +from __future__ import absolute_import
> +from __future__ import print_function
> import string
> import os
> import sys
> import time
> import re
> +from six.moves import range
> 
> ############################################################################
> ##                          PARAMETER
> @@ -21,11 +24,11 @@
> 
> #SECURITY POINT
>     if type(list_input)!=list:
> -        print 'subroutine need at least two files for fuse'
> +        print('subroutine need at least two files for fuse')
>         return 0
> 
>     if output in list_input:
> -        print 'output file cann\'t have the same name than an input file'
> +        print('output file cann\'t have the same name than an input file')
>         return 0
> 
> #initialisation
> @@ -179,7 +182,7 @@
> 
>     file_in.close()
>     file_out.close()
> -    print 'no need of mod_photon_flux'
> +    print('no need of mod_photon_flux')
>     sys.exit()
>     return
> 
> 
> === modified file 'Template/NLO/Cards/run_card.dat'
> --- Template/NLO/Cards/run_card.dat	2018-04-25 06:47:06 +0000
> +++ Template/NLO/Cards/run_card.dat	2021-03-24 10:12:56 +0000
> @@ -179,7 +179,8 @@
>   %(pt_max_pdg)s = pt_max_pdg ! Max pT for a massive particle
>   %(mxx_min_pdg)s = mxx_min_pdg ! inv. mass for any pair of (anti)particles
> #***********************************************************************
> -# For aMCfast+APPLGRID use in PDF fitting (http://amcfast.hepforge.org)*
> +# Use PineAPPL to generate PDF-independent fast-interpolation grid     *
> +# (https://zenodo.org/record/3992765#.X2EWy5MzbVo)                     *
> #***********************************************************************
> - %(iappl)s = iappl ! aMCfast switch (0=OFF, 1=prepare grids, 2=fill grids)
> + %(pineappl)s = pineappl ! PineAPPL switch 
> #***********************************************************************
> 
> === modified file 'Template/NLO/Cards/shower_card.dat'
> --- Template/NLO/Cards/shower_card.dat	2017-08-15 19:34:40 +0000
> +++ Template/NLO/Cards/shower_card.dat	2021-03-24 10:12:56 +0000
> @@ -57,7 +57,8 @@
> # FxFx merging parameters                             !ONLY FOR PYTHIA8!
> #***********************************************************************
> Qcut       = -1.0     # Merging scale
> -njmax      = 0        # Maximal multiplicity in the merging
> +njmax      = -1       # Maximal multiplicity in the merging.
> +#                     # -1 means guessed  from the process definition
> #***********************************************************************
> # Decay channels                                                       *
> #***********************************************************************
> @@ -127,6 +128,8 @@
>                                  # Dir names separated by white spaces
> ANALYSE      =                   # User's analysis and histogramming
>                                  # routines (please use .o as extension
> -                                 # and use spaces to separate files)
> +                                 # and use spaces to separate files).
> +                                 # If the HwU.o files has to be linked,
> +                                 # it should be put *first*.
> 
> 
> 
> === modified file 'Template/NLO/FixedOrderAnalysis/HwU.f'
> --- Template/NLO/FixedOrderAnalysis/HwU.f	2017-06-21 11:53:16 +0000
> +++ Template/NLO/FixedOrderAnalysis/HwU.f	2021-03-24 10:12:56 +0000
> @@ -10,16 +10,29 @@
> C                                                                          C
> CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
> 
> +      module HwU_wgts_info_len
> +         use iso_c_binding
> +         integer, parameter :: wgts_info_len=80 
> +         contains 
> +             integer function get_wgts_info_len() bind(c,name="get_wgts_info_len")
> +                 get_wgts_info_len = wgts_info_len
> +                 return
> +             end function get_wgts_info_len
> +
> +      end module HwU_wgts_info_len
> +
> +
> c The module contains effectively the common block with allocatable
> c variables (something not possible in old fortran version)
>       module HwU_variables
> +         use HwU_wgts_info_len
>          implicit none
>          integer :: max_plots,max_points,max_bins,nwgts,np
>          integer :: error_estimation=3
>          logical, allocatable :: booked(:)
>          integer, allocatable :: nbin(:),histi(:,:),p_bin(:),p_label(:)
>          character(len=50), allocatable :: title(:)
> -         character(len=50), allocatable :: wgts_info(:)
> +         character(len=wgts_info_len), allocatable :: wgts_info(:)
>          double precision, allocatable :: histy(:,:,:),histy_acc(:,:,:)
>      $        ,histy2(:,:),histy_err(:,:),histxl(:,:),histxm(:,:)
>      $        ,step(:),p_wgts(:,:)
> @@ -34,6 +47,16 @@
>       implicit none
>       integer i,nweights
>       character*(*) wgt_info(*)
> +
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +
> +C     Initialize the number of bins of the aMCfast grids
> +      if(pineappl) appl_obs_nbins = 0
> +
>       call HwU_deallocate_all
>       max_plots=0
>       max_points=0
> @@ -85,6 +108,43 @@
>       integer label,nbin_l,i,j
>       character*(*) title_l
>       double precision xmin,xmax
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      double precision del
> +
> +c     Initialize the grids only if the switch "pineappl" is set to True
> +c     and if the title  does not contain the word "Born". 
> +      if(pineappl.and.index(title_l,"Born").eq.0)then
> +c     Observable parameters
> +c     Compute number of bins and edges only if they have not been given by the user.
> +         if(appl_obs_nbins.eq.0)then
> +            appl_obs_nbins = nbin_l
> +            ! bin width
> +            del = (xmax - xmin) / nbin_l
> +c     compute bin edges
> +            do i=0,appl_obs_nbins
> +               appl_obs_bins(i) = xmin + i * del
> +            enddo
> +         endif
> +         appl_obs_min = appl_obs_bins(0)
> +         appl_obs_max = appl_obs_bins(appl_obs_nbins)
> +         if(abs(appl_obs_max-xmax).gt.0.00000001d0)then
> +            write(*,*) 'PineAPPL Histogram: ', 
> +     1                 'Change of the upper limit:',xmax,'-->',
> +     2                  appl_obs_max
> +         endif
> +c     Initialize PineAPPL routines
> +         call APPL_init
> +c     Keep track of the position of this histogram
> +         nh_obs = nh_obs + 1
> +         ih_obs(nh_obs) = label
> +c     Reset number of bins to zero
> +         appl_obs_nbins = 0
> +      endif
> +
> c     Allocate space for new histograms if needed      
>       call HwU_allocate_histo(label,nbin_l)
> c     Setup the histogram
> @@ -119,6 +179,24 @@
>       implicit none
>       integer label,i,j,bin
>       double precision x, wgts(*)
> +
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      if(pineappl)then
> +         do j=1,nh_obs
> +            if(label.eq.ih_obs(j))then
> +               appl_obs_num   = j
> +               appl_obs_histo = x
> +c     Fill the reference PineAPPL histograms
> +c     Fill the PineAPPL files
> +               call APPL_fill
> +            endif
> +         enddo
> +      endif
> +
> c     If central weight is zero do not add this point.
>       if (wgts(1).eq.0d0) return
> c     Check if point is within plotting range
> 
> === added file 'Template/NLO/FixedOrderAnalysis/analysis_td_hw_orders.f'
> --- Template/NLO/FixedOrderAnalysis/analysis_td_hw_orders.f	1970-01-01 00:00:00 +0000
> +++ Template/NLO/FixedOrderAnalysis/analysis_td_hw_orders.f	2021-03-24 10:12:56 +0000
> @@ -0,0 +1,190 @@
> +c
> +c This file contains the default histograms for fixed order runs: it
> +c only plots the total rate as an example. It can be used as a template
> +c to make distributions for other observables.
> +c
> +c This uses the hbook package and generates histograms in the top-drawer
> +c format. This format is human-readable. After running, the histograms
> +c can be found in the Events/run_XX/ directory.
> +c
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +      subroutine analysis_begin(nwgt,weights_info)
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +c This subroutine is called once at the start of each run. Here the
> +c histograms should be declared. 
> +c
> +c Declare the histograms using 'bookup'.
> +c     o) The first argument is an integer that labels the histogram. In
> +c     the analysis_end and analysis_fill subroutines this label is used
> +c     to keep track of the histogram. The label should be a number
> +c     between 1 and NPLOTS/4=5000 (can be increased in dbook.inc).
> +c     o) The second argument is a string that will apear above the
> +c     histogram. Do not use brackets "(" or ")" inside this string.
> +c     o) The third, forth and fifth arguments are the bin size, the
> +c     lower edge of the first bin and the upper edge of the last
> +c     bin. There is a maximum of 100 bins per histogram.
> +c     o) When including scale and/or PDF uncertainties, declare a
> +c     histogram for each weight, and compute the uncertainties from the
> +c     final set of histograms
> +c
> +      implicit none
> +c When including scale and/or PDF uncertainties the total number of
> +c weights considered is nwgt
> +      integer nwgt
> +c In the weights_info, there is an text string that explains what each
> +c weight will mean. The size of this array of strings is equal to nwgt.
> +      character*(*) weights_info(*)
> +c Local variables
> +      integer kk,l,nwgt_analysis
> +      common/c_analysis/nwgt_analysis
> +c Initialize the histogramming package (hbook):
> +      call inihist
> +c Fill the c_analysis common block with the number of weights that will
> +c be computed
> +      nwgt_analysis=nwgt
> +c
> +c loop over all the weights that are computed (depends on run_card
> +c parameters do_rwgt_scale and do_rwgt_pdf):
> +      do kk=1,nwgt_analysis
> +c make sure that there is a separate histogram initialized for each
> +c weight
> +         l=(kk-1)*4
> +c declare (i.e. book) the histograms
> +         call bookup(l+1,'total rate      '//weights_info(kk),
> +     &        1.0d0,0.5d0,5.5d0)
> +         call bookup(l+2,'total rate Born '//weights_info(kk),
> +     &        1.0d0,0.5d0,5.5d0)
> +         call bookup(l+3,'total rate QCD'//weights_info(kk),
> +     &        1.0d0,0.5d0,5.5d0)
> +         call bookup(l+4,'total rate EW '//weights_info(kk),
> +     &        1.0d0,0.5d0,5.5d0)
> +      enddo
> +      return
> +      end
> +
> +
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +      subroutine analysis_end(xnorm)
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +c This subroutine is called once at the end of the run. Here the
> +c histograms are written to disk. Note that this is done for each
> +c integration channel separately. There is an external script that will
> +c read the top drawer files in each of the integration channels and
> +c combines them by summing all the bins in a final single top-drawer
> +c file to be put in the Events/run_XX directory.
> +c      
> +c The histograms are put in a format to be written to file. Use the
> +c multitop() subroutine.
> +c     o) The first argument is the histogram label
> +c     o) The second and third arguments are not used (keep them to the
> +c     default 3,2)
> +c     o) Fourth argument is the label for the x-axis. Do not use
> +c     brackets "(" or ")" inside this string.
> +c     o) Fifth argument is the y-axis
> +c     o) Final argument declares if the y-axis should be a linear 'LIN'
> +c     or logarithmic 'LOG' scale.
> +      implicit none
> +      character*14 ytit
> +      double precision xnorm
> +      integer i
> +c Local variables
> +      integer kk,l,nwgt_analysis
> +      common/c_analysis/nwgt_analysis
> +c This defines NPLOTS:
> +      include 'dbook.inc'
> +c Open the topdrawer file to write the histograms (do not remove the
> +c next to calls)
> +      call open_topdrawer_file
> +      call mclear
> +c Do not touch the folloing 4 lines. These lines make sure that the
> +c histograms will have the correct overall normalisation: cross section
> +c (in pb) per bin.
> +      do i=1,NPLOTS
> +         call mopera(i,'+',i,i,xnorm,0.d0)
> +         call mfinal(i)
> +      enddo
> +      ytit='sigma per bin '
> +c Loop over the plots that are declared with bookup
> +      do kk=1,nwgt_analysis
> +         l=(kk-1)*4
> +         do i=1,8
> +c convert them to a format suitable for writing
> +            call multitop(l+i,3,2,'total rate',ytit,'LIN')
> +         enddo
> +      enddo
> +c Close the topdrawer file (Do not remove this call)
> +      call close_topdrawer_file
> +      return
> +      end
> +
> +
> +
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +      subroutine analysis_fill(p,istatus,ipdg,wgts,ibody)
> +cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
> +c This subroutine is called for each n-body and (n+1)-body configuration
> +c that passes the generation cuts. Here the histrograms are filled.
> +      implicit none
> +c This includes the 'nexternal' parameter that labels the number of
> +c particles in the (n+1)-body process
> +      include 'nexternal.inc'
> +c This is an array which is '-1' for initial state and '1' for final
> +c state particles
> +      integer istatus(nexternal)
> +c This is an array with (simplified) PDG codes for the particles. Note
> +c that channels that are combined (i.e. they have the same matrix
> +c elements) are given only 1 set of PDG codes. This means, e.g., that
> +c when using a 5-flavour scheme calculation (massless b quark), no
> +c b-tagging can be applied.
> +      integer iPDG(nexternal)
> +c The array of the momenta and masses of the initial and final state
> +c particles in the lab frame. The format is "E, px, py, pz, mass", while
> +c the second dimension loops over the particles in the process. Note
> +c that these are the (n+1)-body particles; for the n-body there is one
> +c momenta equal to all zero's (this is not necessarily the last particle
> +c in the list). If one uses IR-safe obserables only, there should be no
> +c difficulty in using this.
> +      double precision p(0:4,nexternal)
> +c The weight of the current phase-space point is wgts(1). If scale
> +c and/or PDF uncertainties are included through reweighting, the rest of
> +c the array contains the list of weights in the same order as described
> +c by the weigths_info strings in analysis_begin
> +      double precision wgts(*)
> +c The ibody variable is:
> +c     ibody=1 : (n+1)-body contribution
> +c     ibody=2 : n-body contribution (excluding the Born)
> +c     ibody=3 : Born contribution
> +c The histograms need to be filled for all these contribution to get the
> +c physics NLO results. (Note that the adaptive phase-space integration
> +c is optimized using the sum of the contributions, therefore plotting
> +c them separately might lead to larger than expected statistical
> +c fluctuations).
> +      integer ibody
> +c local variables
> +      double precision wgt,var
> +      integer kk,l,nwgt_analysis
> +      common/c_analysis/nwgt_analysis
> +      ! stuff for plotting the different splitorders
> +      integer orders_tag_plot
> +      common /corderstagplot/ orders_tag_plot
> +c
> +c Fill the histograms here using a call to the mfill() subroutine. The
> +c first argument is the histogram label, the second is the numerical
> +c value of the variable to plot for the current phase-space point and
> +c the final argument is the weight of the current phase-space point.
> +      var=1d0
> +c loop over all the weights that are computed (depends on run_card
> +c parameters do_rwgt_scale and do_rwgt_pdf):
> +      do kk=1,nwgt_analysis
> +         wgt=wgts(kk)
> +         l=(kk-1)*4
> +c always fill the total rate
> +         call mfill(l+1,var,wgt)
> +c only fill the total rate for the Born when ibody=3
> +         if (ibody.eq.3) call mfill(l+2,var,wgt)
> +C fill the different partonic subchannels         
> +         if (orders_tag_plot.eq.402) call mfill(l+3,var,wgt)
> +         if (orders_tag_plot.eq.600) call mfill(l+4,var,wgt)
> +      enddo
> +      return
> +      end
> 
> === modified file 'Template/NLO/FixedOrderAnalysis/dbook.f'
> --- Template/NLO/FixedOrderAnalysis/dbook.f	2015-03-04 10:22:46 +0000
> +++ Template/NLO/FixedOrderAnalysis/dbook.f	2021-03-24 10:12:56 +0000
> @@ -124,11 +124,11 @@
> c     initialization
>       IMPLICIT NONE
>       include 'dbook.inc'
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> c
> c     LOCAL
> c
> @@ -139,8 +139,8 @@
>       NHIST=0
>       DO 1, I=1,NPLOTS             
>    1  BOOK(I)=' NO'
> -C     Initialize the number of bins of the aMCfast grids
> -      if(iappl.ne.0) appl_obs_nbins = 0
> +C     Initialize the number of bins of the amcblast grids
> +      if(pineappl) appl_obs_nbins = 0
>       END  
> 
> 
> @@ -1001,20 +1001,19 @@
>       implicit none
>       integer n,n_by4
>       double precision var,www
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       integer j
> -      if(iappl.ne.0)then
> +      if(pineappl)then
>          do j=1,nh_obs
>             if(n.eq.ih_obs(j))then
>                appl_obs_num   = j
>                appl_obs_histo = var 
> -c     Fill the reference APPLgrid histograms
> -               call APPL_fill_ref
> -c     Fill the APPLgrid files
> +c     Fill the reference PineAPPL histograms
> +c     Fill the PineAPPL files
>                call APPL_fill
>             endif
>          enddo
> @@ -1029,15 +1028,15 @@
>       integer i,n,n_by4
>       character*(*) string
>       double precision del,xl,xu
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> -c     Initialize the grids only if the switch "iappl" is different from zero
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +c     Initialize the grids only if the switch "pineappl" is different from zero
> c     and if the title string containes the word "central" and does not contain
> c     the word "Born". 
> -      if(iappl.ne.0.and.index(string,"central").ne.0.and.
> +      if(pineappl.and.index(string,"central").ne.0.and.
>      1                  index(string,"Born").eq.0)then
> c     Observable parameters
> c     Compute number of bins and edges only if they have not been given by the user.
> @@ -1051,11 +1050,11 @@
>          appl_obs_min = appl_obs_bins(0)
>          appl_obs_max = appl_obs_bins(appl_obs_nbins)
>          if(abs(appl_obs_max-xu).gt.0.00000001d0)then
> -            write(*,*) 'APPLgrid Histogram: ', 
> +            write(*,*) 'PineAPPL Histogram: ', 
>      1                 'Change of the upper limit:',xu,'-->',
>      2                  appl_obs_max
>          endif
> -c     Initialize APPLgrid routines
> +c     Initialize PineAPPL routines
>          call APPL_init
> c     Keep track of the position of this histogram
>          nh_obs = nh_obs + 1
> @@ -1072,17 +1071,16 @@
>       implicit none
>       integer n,n_by4,m_by4
>       character*(*) string1,string2,string3
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       integer j
> -      if(iappl.ne.0)then
> +      if(pineappl)then
>          do j=1,nh_obs
>             if(n.eq.ih_obs(j))then
>                appl_obs_num = j
> -               call APPL_fill_ref_out
>                call APPL_term
>             endif
>          enddo
> @@ -1098,17 +1096,16 @@
>       implicit none
>       integer n,n_by4,lr,lh,m_by4
>       character*(*) string1,string2,string3
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       integer j
> -      if(iappl.ne.0)then
> +      if(pineappl)then
>          do j=1,nh_obs
>             if(n.eq.ih_obs(j))then
>                appl_obs_num = j
> -               call APPL_fill_ref_out
>                call APPL_term
>             endif
>          enddo
> 
> === modified file 'Template/NLO/FixedOrderAnalysis/rbook_fe8.f'
> --- Template/NLO/FixedOrderAnalysis/rbook_fe8.f	2014-06-30 10:49:23 +0000
> +++ Template/NLO/FixedOrderAnalysis/rbook_fe8.f	2021-03-24 10:12:56 +0000
> @@ -95,24 +95,24 @@
>        integer id,nbin
>        double precision xbin,xlo,xhi
> 
> -c      APPLgrid commons
> -       include "reweight_appl.inc"
> -       include "appl_common.inc"
> -       integer iappl
> -       common /for_applgrid/ iappl
> +c      PineAPPL commons
> +       include "reweight_pineappl.inc"
> +       include "pineappl_common.inc"
> +       logical pineappl
> +       common /for_pineappl/ pineappl
> 
>        nbin = int((xhi-xlo)/(xbin*0.9999d0))
> 
> -c      Initialize the grids only if the switch "iappl" is different from zero
> +c      Initialize the grids only if the switch "pineappl" is different from zero
> c      and if the title string containes the word "central" and does not contain
> c      the word "Born".
> -       if(iappl.ne.0.and.index(name,"central").ne.0.and.
> +       if(pineappl.and.index(name,"central").ne.0.and.
>      1                   index(name,"Born").eq.0)then
> c      Observable parameters
>           appl_obs_nbins = nbin
>           appl_obs_min   = xlo
>           appl_obs_max   = xhi
> -c      Initialize APPLgrid routines
> +c      Initialize PineAPPL routines
>           call APPL_init
> c      Keep track of the position of this histogram
>           nh_obs = nh_obs + 1
> @@ -150,21 +150,20 @@
>        integer ihisto
>        double precision xval,wgt
> 
> -c      APPLgrid commons
> -       include "reweight_appl.inc"
> -       include "appl_common.inc"
> -       integer iappl
> -       common /for_applgrid/ iappl
> +c      PineAPPL commons
> +       include "reweight_pineappl.inc"
> +       include "pineappl_common.inc"
> +       logical pineappl
> +       common /for_pineappl/ pineappl
>        integer j
> c
> -       if(iappl.ne.0)then
> +       if(pineappl)then
>           do j=1,nh_obs
>              if(ihisto.eq.ih_obs(j))then
>                 appl_obs_num   = j
>                 appl_obs_histo = xval
> -c      Fill the reference APPLgrid histograms
> -                call APPL_fill_ref
> -c      Fill the APPLgrid files
> +c      Fill the reference PineAPPL histograms
> +c      Fill the PineAPPL files
>                 call APPL_fill
>              endif
>           enddo
> @@ -198,17 +197,16 @@
>       character*(*) oper
>       double precision x,y
> 
> -c     APPLgrid commons
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c     PineAPPL commons
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       integer j
> -      if(iappl.ne.0)then
> +      if(pineappl)then
>          do j=1,nh_obs
>             if(ih1.eq.ih_obs(j))then
>                appl_obs_num = j
> -               call APPL_fill_ref_out
>                call APPL_term
>             endif
>          enddo
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_V.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_V.f	2017-02-02 08:59:42 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_V.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       real * 8 xm0,gam,xmlow,xmupp,bin
> @@ -49,7 +50,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_h.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_h.f	2016-03-21 08:45:42 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_h.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
> c
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis,kk,l
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_hjj.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_hjj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_hjj.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
> c
> @@ -51,7 +52,7 @@
>       common /to_veto_hist/vetomin,vetomax,nbinveto
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_leptons.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_leptons.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_leptons.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
> c
> @@ -60,7 +61,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lplm.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lplm.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lplm.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       real * 8 bin,xmi,xms,pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lvl.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lvl.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_lvl.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       real * 8 bin,xmi,xms,pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_taptam.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_taptam.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_taptam.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
> c
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis,kk,l
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_tj.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_tj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_tj.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx_v2.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx_v2.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_pp_ttx_v2.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_rates.f'
> --- Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_rates.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/HWAnalyzer/hw6an_HwU_rates.f	2021-03-24 10:12:56 +0000
> @@ -23,6 +23,7 @@
>       SUBROUTINE HWABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
>       include 'reweight0.inc'
> c
> @@ -42,7 +43,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/Makefile_MadFKS'
> --- Template/NLO/MCatNLO/Makefile_MadFKS	2018-07-06 13:15:54 +0000
> +++ Template/NLO/MCatNLO/Makefile_MadFKS	2021-03-24 10:12:56 +0000
> @@ -43,10 +43,10 @@
> PDFFILES=$(OBJDIR)/mcatnlo_pdftomlm.o $(OBJDIR)/mcatnlo_libofpdf.o $(OBJDIR)/dummies.o
> CPDFFILES=$(OBJDIR)/mcatnlo_mlmtopdf.o $(OBJDIR)/dummies.o
> LPDFFILES=$(OBJDIR)/mcatnlo_mlmtolha.o $(OBJDIR)/dummies.o
> -HWFILES=$(OBJDIR)/$(HERWIGVER) $(OBJDIR)/madfks_hwdriver.o $(OBJDIR)/madfks_hwlhin.o \
> -        $(OBJDIR)/mcatnlo_str.o $(HWUTI)
> -PYFILES=$(OBJDIR)/$(PYTHIAVER) $(OBJDIR)/madfks_pydriver.o $(OBJDIR)/madfks_pylhin.o \
> -        $(OBJDIR)/mcatnlo_str.o $(PYUTI)
> +HWFILES=$(HWUTI) $(OBJDIR)/$(HERWIGVER) $(OBJDIR)/madfks_hwdriver.o $(OBJDIR)/madfks_hwlhin.o \
> +        $(OBJDIR)/mcatnlo_str.o 
> +PYFILES=$(PYUTI) $(OBJDIR)/$(PYTHIAVER) $(OBJDIR)/madfks_pydriver.o $(OBJDIR)/madfks_pylhin.o \
> +        $(OBJDIR)/mcatnlo_str.o
> 
> 
> HW_EXE_DEFAULT : $(HWFILES) $(PDFFILES)
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_V.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_V.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_V.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       real * 8 xm0,gam,xmlow,xmupp,bin
> @@ -48,7 +49,7 @@
>       data cc/'     ','Born '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_h.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_h.f	2016-07-21 14:37:54 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_h.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -45,7 +46,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_hjj.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_hjj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_hjj.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -45,7 +46,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
>       character*8 cc(2)
>       data cc/'        ','vbfcuts '/
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_leptons.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_leptons.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_leptons.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
> c
> @@ -43,7 +44,7 @@
>       integer j,jpr
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
>       integer nsingle,ncorr,nlepton,nplots,ncuts
>       common/cplots/nsingle,ncorr,nlepton,nplots,ncuts
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lplm.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lplm.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lplm.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       real * 8 bin,xmi,xms,pi
> @@ -47,7 +48,7 @@
>       data cc/'     ','Born '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lvl.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lvl.f	2016-12-07 21:05:19 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_lvl.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       real * 8 bin,xmi,xms,pi
> @@ -47,7 +48,7 @@
>       data cc/'     ','Born '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_taptam.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_taptam.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_taptam.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       integer j,kk,l,i,nnn
> @@ -43,7 +44,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_tj.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_tj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_tj.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -45,7 +46,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -45,7 +46,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx_v2.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx_v2.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_pp_ttx_v2.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -45,7 +46,7 @@
>       data HwUtype/'|T@NOCUT','|T@CUT  '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_rates.f'
> --- Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_rates.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PY8Analyzer/py8an_HwU_rates.f	2021-03-24 10:12:56 +0000
> @@ -23,6 +23,7 @@
>       SUBROUTINE PYABEG(nnn,wwwi)
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HEPMC.INC'
>       include 'reweight0.inc'
> c
> @@ -41,7 +42,7 @@
>       data cc/'     ','Born '/
>       integer nwgt_analysis
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>      $     ,wwwi(max_weight_shower)
> c
>       do i=1,nnn
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_V.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_V.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_V.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit double precision(a-h, o-z)
>       implicit integer(i-n)
>       common/pydat2/kchg(500,4),pmas(500,4),parf(2000),vckm(4,4)
> @@ -51,7 +52,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_h.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_h.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_h.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_hjj.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_hjj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_hjj.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
> c
> @@ -52,7 +53,7 @@
>       common /to_veto_hist/vetomin,vetomax,nbinveto
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_leptons.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_leptons.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_leptons.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
> c
> @@ -59,7 +60,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lplm.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lplm.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lplm.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       real * 8 bin,xmi,xms,pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lvl.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lvl.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_lvl.f	2021-03-24 10:12:56 +0000
> @@ -27,6 +27,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit double precision(a-h, o-z)
>       implicit integer(i-n)
>       common/pydat2/kchg(500,4),pmas(500,4),parf(2000),vckm(4,4)
> @@ -50,7 +51,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_taptam.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_taptam.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_taptam.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       integer j,kk,l,i
> @@ -46,7 +47,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_tj.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_tj.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_tj.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx_v2.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx_v2.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_pp_ttx_v2.f	2021-03-24 10:12:56 +0000
> @@ -28,6 +28,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
>       REAL*8 pi
> @@ -48,7 +49,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c
> c Initialize histograms
> 
> === modified file 'Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_rates.f'
> --- Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_rates.f	2016-02-23 10:48:46 +0000
> +++ Template/NLO/MCatNLO/PYAnalyzer/py6an_HwU_rates.f	2021-03-24 10:12:56 +0000
> @@ -23,6 +23,7 @@
>       SUBROUTINE PYABEG
> C     USER''S ROUTINE FOR INITIALIZATION
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       implicit none
>       include 'reweight0.inc'
> c
> @@ -42,7 +43,7 @@
>       integer nwgt,max_weight,nwgt_analysis
>       common/cnwgt/nwgt
>       common/c_analysis/nwgt_analysis
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> c Initialize histograms
>       call HwU_inithist(nwgt,weights_info)
> 
> === modified file 'Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_HERWIG6.Script'
> --- Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_HERWIG6.Script	2014-11-10 09:33:16 +0000
> +++ Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_HERWIG6.Script	2021-03-24 10:12:56 +0000
> @@ -141,7 +141,7 @@
> EXEC_NAME=
> EXEC_NAMEF=
> EXEC_NAMEFF=
> -HWUTI+=' jimmy.o'
> +HWUTI+=' pineappl_interface_dummy.o jimmy.o HwU.o'
> read -a HWUTIA <<< "$HWUTI"
> HWUTI=
> for i in "${HWUTIA[@]}"; do HWUTI+=`pwd`"/objects/$i "; done
> 
> === modified file 'Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6PT.Script'
> --- Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6PT.Script	2014-11-10 09:33:16 +0000
> +++ Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6PT.Script	2021-03-24 10:12:56 +0000
> @@ -141,6 +141,7 @@
> EXEC_NAME=
> EXEC_NAMEF=
> EXEC_NAMEFF=
> +PYUTI+=' pineappl_interface_dummy.o HwU.o'
> read -a PYUTIA <<< "$PYUTI"
> PYUTI=
> for i in "${PYUTIA[@]}"; do PYUTI+=`pwd`"/objects/$i "; done
> 
> === modified file 'Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6Q.Script'
> --- Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6Q.Script	2014-11-10 09:33:16 +0000
> +++ Template/NLO/MCatNLO/Scripts/MCatNLO_MadFKS_PYTHIA6Q.Script	2021-03-24 10:12:56 +0000
> @@ -141,6 +141,7 @@
> EXEC_NAME=
> EXEC_NAMEF=
> EXEC_NAMEFF=
> +PYUTI+=' pineappl_interface_dummy.o HwU.o'
> read -a PYUTIA <<< "$PYUTI"
> PYUTI=
> for i in "${PYUTIA[@]}"; do PYUTI+=`pwd`"/objects/$i "; done
> 
> === modified file 'Template/NLO/MCatNLO/include/LHEFRead.h'
> --- Template/NLO/MCatNLO/include/LHEFRead.h	2016-02-23 11:25:37 +0000
> +++ Template/NLO/MCatNLO/include/LHEFRead.h	2021-03-24 10:12:56 +0000
> @@ -2,6 +2,13 @@
> #include <iomanip>
> #include <string>
> 
> +
> +extern "C" {
> +    int get_wgts_info_len(void);
> +}
> +
> +const int wgts_info_len_used = 80;
> +
> class MyReader {
> 
>   private:
> @@ -16,12 +23,22 @@
>   LHEF::Reader reader;
> 
> 
> -  void lhef_read_wgtsinfo_(int &cwgtinfo_nn, char (cwgtinfo_weights_info[1024][50])) {
> +  void lhef_read_wgtsinfo_(int &cwgtinfo_nn, char (cwgtinfo_weights_info[1024][wgts_info_len_used])) {
> +
> +    // check that wgts_info_len_used > wgts_info_len from the fortran module
> +    if (wgts_info_len_used != get_wgts_info_len()) {
> +      std::cout << " wgts_info_len_used is different from the corresponding quantity in HwU_wgts_info_len\n"
> +                << " Please set wgts_info_len_used in LHEFRead.h to "<< get_wgts_info_len() <<"\n"
> +                << " Program stopped.\n";
> +      exit(1);
> +    }
> 
>     // Read header of event file
>     std::stringstream hss;
>     std::string hs;
> -    sprintf(cwgtinfo_weights_info[0], "%50s","central value");
> +    std::stringstream format_str;
> +    format_str <<"%"<<wgts_info_len_used<<"s";
> +    sprintf(cwgtinfo_weights_info[0],format_str.str().c_str(),"central value");
>     cwgtinfo_nn=1;
>     while (true){
>       hss << reader.headerBlock;
> @@ -37,7 +54,7 @@
> 	  if (hs.find("<weight id") != std::string::npos) {
> 	    std::string sRWGT = hs.substr(hs.find("'>")+2,hs.find("</w")-3);
> 	    sRWGT = sRWGT.substr(0,sRWGT.find("<"));
> -	    sprintf(cwgtinfo_weights_info[cwgtinfo_nn],"%50s",sRWGT.c_str());
> +	    sprintf(cwgtinfo_weights_info[cwgtinfo_nn],format_str.str().c_str(),sRWGT.c_str());
> 	    ++cwgtinfo_nn;
> 	  }
> 	}
> 
> === added file 'Template/NLO/MCatNLO/include/orders.inc'
> --- Template/NLO/MCatNLO/include/orders.inc	1970-01-01 00:00:00 +0000
> +++ Template/NLO/MCatNLO/include/orders.inc	2021-03-24 10:12:56 +0000
> @@ -0,0 +1,5 @@
> +C WARNING: this is a dummy file to make the code for showering compile
> +C DO NOT USE ELSEWHERE
> +      integer amp_split_size
> +      parameter (amp_split_size = 2)
> +C =================================================================
> 
> === added symlink 'Template/NLO/MCatNLO/include/pineappl_common.inc'
> === target is '../../SubProcesses/pineappl_common.inc'
> === added symlink 'Template/NLO/MCatNLO/include/pineappl_maxproc.inc'
> === target is '../../SubProcesses/pineappl_maxproc.inc'
> === added symlink 'Template/NLO/MCatNLO/include/reweight_pineappl.inc'
> === target is '../../SubProcesses/reweight_pineappl.inc'
> === added symlink 'Template/NLO/MCatNLO/srcCommon/pineappl_interface_dummy.f'
> === target is '../../SubProcesses/pineappl_interface_dummy.f'
> === modified file 'Template/NLO/MCatNLO/srcHerwig/madfks_hwlhin.f'
> --- Template/NLO/MCatNLO/srcHerwig/madfks_hwlhin.f	2017-06-19 14:46:09 +0000
> +++ Template/NLO/MCatNLO/srcHerwig/madfks_hwlhin.f	2021-03-24 10:12:56 +0000
> @@ -125,6 +125,7 @@
> C  Reads MC@NLO input headers and fills Les Houches run common HEPRUP
> C  Event file is written by MadFKS
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
>       INCLUDE 'HERWIG65.INC'
> C--Les Houches Common Blocks
>       INTEGER MAXPUP
> @@ -150,7 +151,7 @@
>       include 'reweight0.inc'
>       integer nwgt
>       common/cnwgt/nwgt
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> 
>       nwgt=1
> 
> === modified file 'Template/NLO/MCatNLO/srcPythia/madfks_pylhin.f'
> --- Template/NLO/MCatNLO/srcPythia/madfks_pylhin.f	2017-06-19 14:46:09 +0000
> +++ Template/NLO/MCatNLO/srcPythia/madfks_pylhin.f	2021-03-24 10:12:56 +0000
> @@ -124,6 +124,7 @@
> C  Reads MC@NLO input headers and fills Les Houches run common HEPRUP
> C  Event file is written by MadFKS
> C----------------------------------------------------------------------
> +      use HwU_wgts_info_len
> C--Les Houches Common Blocks
>       INTEGER MAXPUP
>       PARAMETER(MAXPUP=100)
> @@ -149,7 +150,7 @@
>       include 'reweight0.inc'
>       integer nwgt
>       common/cnwgt/nwgt
> -      character*50 weights_info(max_weight_shower)
> +      character*(wgts_info_len) weights_info(max_weight_shower)
>       common/cwgtsinfo/weights_info
> C
>       numscales=0
> 
> === modified file 'Template/NLO/MCatNLO/srcPythia8/Pythia8.cc'
> --- Template/NLO/MCatNLO/srcPythia8/Pythia8.cc	2017-07-25 14:13:14 +0000
> +++ Template/NLO/MCatNLO/srcPythia8/Pythia8.cc	2021-03-24 10:12:56 +0000
> @@ -21,7 +21,7 @@
> #define cevwgt cevwgt_
> 
> extern "C" { 
> -  void pyabeg_(int&,char(*)[50]);
> +  void pyabeg_(int&,char(*)[wgts_info_len_used]);
>   void pyaend_(double&);
>   void pyanal_(int&,double(*));
> }
> @@ -30,7 +30,7 @@
>   Pythia pythia;
> 
>   int cwgtinfo_nn;
> -  char cwgtinfo_weights_info[1024][50];
> +  char cwgtinfo_weights_info[1024][wgts_info_len_used];
>   double cwgt_ww[1024];
> 
>   string inputname="Pythia8.cmd",outputname="Pythia8.hep";
> 
> === modified file 'Template/NLO/MCatNLO/srcPythia8/Pythia82.cc'
> --- Template/NLO/MCatNLO/srcPythia8/Pythia82.cc	2018-05-01 13:46:54 +0000
> +++ Template/NLO/MCatNLO/srcPythia8/Pythia82.cc	2021-03-24 10:12:56 +0000
> @@ -22,7 +22,7 @@
> #define cevwgt cevwgt_
> 
> extern "C" { 
> -  void pyabeg_(int&,char(*)[50]);
> +  void pyabeg_(int&,char(*)[wgts_info_len_used]);
>   void pyaend_(double&);
>   void pyanal_(int&,double(*));
> }
> @@ -31,7 +31,7 @@
>   Pythia pythia;
> 
>   int cwgtinfo_nn;
> -  char cwgtinfo_weights_info[1024][50];
> +  char cwgtinfo_weights_info[1024][wgts_info_len_used];
>   double cwgt_ww[1024];
> 
>   string inputname="Pythia8.cmd",outputname="Pythia8.hep";
> 
> === modified file 'Template/NLO/Source/PDF/makefile'
> --- Template/NLO/Source/PDF/makefile	2018-04-16 14:08:47 +0000
> +++ Template/NLO/Source/PDF/makefile	2021-03-24 10:12:56 +0000
> @@ -13,16 +13,12 @@
> ifdef lhapdf
>   ifeq ($(lhapdfversion),5)
>     PDF         = pdfwrap_lhapdf.o pdf_lhapdf.o pdg2pdf_lhapdf.o opendata.o
> -  else
> -    ifdef applgrid
> -      PDF         = pdfwrap_lhapdf.o pdf_lhapdf.o pdg2pdf_lhapdf.o opendata.o
> -    else # lhapdf6
> -      ifeq ($(lhapdfsubversion),1) # 6.1.X
> -        PDF         = pdfwrap_lhapdf.o pdf_lhapdf6.o pdg2pdf_lhapdf6.o opendata.o
> -      else # 6.2.X
> -        CXXFLAGS+=-std=c++11    
> -        PDF         = pdfwrap_lhapdf.o pdf_lhapdf62.o pdg2pdf_lhapdf6.o opendata.o
> -      endif
> +  else # lhapdf v6
> +    ifeq ($(lhapdfsubversion),1) # 6.1.X
> +      PDF         = pdfwrap_lhapdf.o pdf_lhapdf6.o pdg2pdf_lhapdf6.o opendata.o
> +    else # 6.2.X
> +      CXXFLAGS+=-std=c++11    
> +      PDF         = pdfwrap_lhapdf.o pdf_lhapdf62.o pdg2pdf_lhapdf6.o opendata.o
>     endif
>   endif
> else
> 
> === modified file 'Template/NLO/Source/extra_weights.f'
> --- Template/NLO/Source/extra_weights.f	2017-07-31 08:48:20 +0000
> +++ Template/NLO/Source/extra_weights.f	2021-03-24 10:12:56 +0000
> @@ -1,18 +1,18 @@
>       module extra_weights
> 
>          integer,parameter :: iwgtinfo=-5,maxscales=9,maxPDFs=200
> -     $     ,maxPDFsets=25,maxdynscales=10
> +     $     ,maxPDFsets=25,maxdynscales=10,maxorders=10
>          integer :: max_mom_str=1,max_mext=1,max_n_ctr=1
>          logical :: doreweight,lscalevar(maxdynscales)
>      $        ,lpdfvar(maxPDFsets)
>          integer :: iwgtnumpartn,jwgtinfo,mexternal
>      $        ,lhaPDFid(0:maxPDFsets),nmemPDF(maxPDFsets)
>      $        ,dyn_scale(0:maxdynscales),n_ctr_found,n_mom_conf
> -     $        ,QCD_power,orders_tag
> +     $        ,QCD_power,orders_tag,amp_pos
>          double precision :: wgtdegrem_xi,wgtdegrem_lxi,wgtdegrem_muF
>      $        ,wgtnstmp,wgtwnstmpmuf,wgtwnstmpmur,wgtnstmp_avgvirt
>      $        ,wgtref,scalevarR(0:maxscales),scalevarF(0:maxscales)
> -     $        ,wgtxsecmu(maxscales,maxscales,maxdynscales)
> +     $        ,wgtxsecmu(maxorders,maxscales,maxscales,maxdynscales)
>      $        ,wgtxsecPDF(0:maxPDFs,maxPDFsets),wgtbpower,wgtcpower
>      $        ,veto_multiplier,H1_factor_virt,veto_compensating_factor
>      $        ,born_wgt_veto
> 
> === modified file 'Template/NLO/Source/make_opts.inc'
> --- Template/NLO/Source/make_opts.inc	2018-04-16 14:08:47 +0000
> +++ Template/NLO/Source/make_opts.inc	2021-03-24 10:12:56 +0000
> @@ -111,13 +111,14 @@
>   endif
> endif
> 
> -# Option APPLGrid
> -ifneq ($(applgrid),)
> -  APPLLIBS=$(shell applgrid-config --ldcflags) $(shell amcfast-config --ldflags)
> -  applgrid_interface=appl_interface.o
> +# Option PineAPPL
> +ifneq ($(pineappl),)
> +  APPLLIBS=$(shell pkg-config pineappl_capi --libs)
> +  CXXFLAGS+=$(shell pkg-config pineappl_capi --cflags)
> +  pineappl_interface=pineappl_interface.o
> else
>   APPLLIBS=
> -  applgrid_interface=appl_interface_dummy.o
> +  pineappl_interface=pineappl_interface_dummy.o
> endif
> 
> # Madloop
> 
> === modified file 'Template/NLO/Source/run_printout.f'
> --- Template/NLO/Source/run_printout.f	2012-08-28 21:06:34 +0000
> +++ Template/NLO/Source/run_printout.f	2021-03-24 10:12:56 +0000
> @@ -21,12 +21,17 @@
>       write(6,*)  'Collider parameters:'
>       write(6,*)  '--------------------'
> 
> +      ab(1) = '?'
> +      ab(2) = '?'
>       do i=1,2
>          IF(LPP(i).EQ. 0) ab(i)='e'
>          IF(LPP(i).EQ. 1) ab(i)='P'
>          IF(LPP(i).EQ.-1) ab(i)='Pb'
>          IF(LPP(i).EQ.2) ab(i)='a2'
> -         IF(LPP(i).EQ.3) ab(i)='a3'
> +         IF(LPP(i).EQ.3) ab(i)='e-'
> +         IF(LPP(i).EQ.-3) ab(i)='e+'
> +         IF(LPP(i).EQ.4) ab(i)='m-'
> +         IF(LPP(i).EQ.-4) ab(i)='m+'         
>       enddo
> 
>       ene=2d0*dsqrt(ebeam(1)*ebeam(2))
> 
> === modified file 'Template/NLO/Source/setrun.f'
> --- Template/NLO/Source/setrun.f	2018-04-16 14:08:47 +0000
> +++ Template/NLO/Source/setrun.f	2021-03-24 10:12:56 +0000
> @@ -29,8 +29,8 @@
>       integer nevents
>       character*7 event_norm
>       common /event_normalisation/event_norm
> -      integer iappl
> -      common /for_applgrid/ iappl
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       integer idum
>       logical              fixed_order,nlo_ps
>       common /c_fnlo_nlops/fixed_order,nlo_ps
> @@ -114,7 +114,7 @@
>           write(*,*) 'The default order of alpha_s running is fixed to '
>      &         ,nloop
>       endif
> -      if (nlo_ps) then
> +      if (nlo_ps.or.pineappl) then
> C Fill common block for Les Houches init info
>          do i=1,2
>             if(lpp(i).eq.1.or.lpp(i).eq.2) then
> 
> === modified file 'Template/NLO/SubProcesses/ajob_template'
> --- Template/NLO/SubProcesses/ajob_template	2017-02-13 10:00:30 +0000
> +++ Template/NLO/SubProcesses/ajob_template	2021-03-24 10:12:56 +0000
> @@ -31,6 +31,10 @@
> runnumber=$3
> integration_step=$4
> 
> +FO_EXTRAPATHS=
> +export LD_LIBRARY_PATH=$FO_EXTRAPATHS:$LD_LIBRARY_PATH
> +export DYLD_LIBRARY_PATH=$FO_EXTRAPATHS:$DYLD_LIBRARY_PATH
> +
> TAGTAGTAGTAGTAGTAGTAG for i in 1 ; do
> 
>     if [[ $run_mode == 'all' || $run_mode == 'born' ]] ; then
> 
> === modified file 'Template/NLO/SubProcesses/collect_events.f'
> --- Template/NLO/SubProcesses/collect_events.f	2017-07-29 08:03:34 +0000
> +++ Template/NLO/SubProcesses/collect_events.f	2021-03-24 10:12:56 +0000
> @@ -53,6 +53,8 @@
>       open(unit=10,file=basicfile,status='old')
>       open(unit=98,file=nextbasicfile,status='unknown')
> 
> +      call get_orderstags_glob_infos()
> +
> c
> c First get the cross section from the res_1 files
> c
> @@ -253,6 +255,10 @@
>       double precision xsec(100),xsecABS,xerr(100)
>       logical get_xsec_from_res1
>       common/total_xsec/xsec,xerr,xsecABS,proc_id_tot,get_xsec_from_res1
> +c Common blocks for the orders tags
> +      integer n_orderstags,oo
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> c
>       maxevt=0
>       if (.not. get_xsec_from_res1) then
> @@ -420,18 +426,20 @@
> c reweighting
>            evwgt_sign=dsign(evwgt,XWGTUP)
>            if (do_rwgt_scale) then
> -              do kk=1,dyn_scale(0)
> -                 if (lscalevar(kk)) then
> -                    do ii=1,nint(scalevarF(0))
> -                       do jj=1,nint(scalevarR(0))
> -                          wgtxsecmu(jj,ii,kk)=wgtxsecmu(jj,ii,kk)
> -     $                         *evwgt_sign/XWGTUP
> +              do oo=0,n_orderstags
> +                 do kk=1,dyn_scale(0)
> +                    if (lscalevar(kk)) then
> +                       do ii=1,nint(scalevarF(0))
> +                          do jj=1,nint(scalevarR(0))
> +                             wgtxsecmu(oo,jj,ii,kk)=wgtxsecmu(oo,jj,ii,kk)
> +     $                            *evwgt_sign/XWGTUP
> +                          enddo
>                        enddo
> -                    enddo
> -                 else
> -                    wgtxsecmu(1,1,kk)=wgtxsecmu(1,1,kk)
> -     $                   *evwgt_sign/XWGTUP
> -                 endif
> +                    else
> +                       wgtxsecmu(oo,1,1,kk)=wgtxsecmu(oo,1,1,kk)
> +     $                      *evwgt_sign/XWGTUP
> +                    endif
> +                 enddo
>               enddo
>            endif
>            if (do_rwgt_pdf) then
> 
> === modified file 'Template/NLO/SubProcesses/cuts.f'
> --- Template/NLO/SubProcesses/cuts.f	2020-06-21 21:31:33 +0000
> +++ Template/NLO/SubProcesses/cuts.f	2021-03-24 10:12:56 +0000
> @@ -175,7 +175,7 @@
> 
> c If we do not require a mimimum jet energy, there's no need to apply
> c jet clustering and all that.
> -      if (ptj.ne.0d0.or.ptgmin.ne.0d0) then
> +      if (ptj.gt.0d0.or.ptgmin.gt.0d0) then
> c Put all (light) QCD partons in momentum array for jet clustering.
> c From the run_card.dat, maxjetflavor defines if b quark should be
> c considered here (via the logical variable 'is_a_jet').  nQCD becomes
> @@ -284,7 +284,7 @@
>             is_a_ph(i)=.false.
>          endif
>       enddo
> -      if (ptgmin.ne.0d0) then
> +      if (ptgmin.gt.0d0) then
>          nph=0
>          do j=nincoming+1,nexternal
>             if (is_a_ph(j)) then
> @@ -442,150 +442,6 @@
> 
> 
> 
> -
> -      subroutine recombine_momenta(R, etaph, reco_l, reco_q, p_in, pdg_in, p_out, pdg_out)
> -      implicit none
> -      ! recombine photons with the closest fermion if the distance is
> -      ! less than R and if the rapidity of photons is < etaph (etaph < 0
> -      ! means no cut). Output a new set of momenta and pdgs corresponding
> -      ! to the recombined particles. If recombination occurs the photon
> -      ! disappears from the output particles
> -      ! arguments
> -      include 'nexternal.inc'
> -      double precision R, etaph, p_in(0:4,nexternal), p_out(0:4,nexternal)
> -      logical reco_l, reco_q
> -      integer pdg_in(nexternal), pdg_out(nexternal)
> -      ! local variables
> -      integer nq, nl
> -      integer id_ph
> -      parameter (id_ph=22)
> -      integer n_ph, i_ph
> -      integer i,j
> -      integer ifreco
> -      double precision dreco, dthis
> -      integer skip
> -      logical is_light_charged_fermion
> -      double precision R2_04, eta_04
> -      ! 
> -      integer times_reco
> -      common/to_times_reco/ times_reco
> -      ! reset everything
> -      do j=1,nexternal
> -        pdg_out(j)=0
> -        do i=0,4
> -          p_out(i,j)=0d0
> -        enddo
> -      enddo
> -
> -      ! check if we want to recombine with leptons
> -      if (reco_l) then
> -          nl = 3
> -      else 
> -          nl = 0
> -      endif
> -
> -      ! check if we want to recombine with quarks
> -      if (reco_q) then
> -          nq = 5
> -      else 
> -          nq = 0
> -      endif
> -
> -      ! count the photons
> -      n_ph=0
> -      do i=nincoming+1, nexternal
> -        if (pdg_in(i).eq.id_ph.and.
> -     $   (abs(eta_04(p_in(0,i))).lt.etaph.or.etaph.lt.0d0)) then
> -            n_ph=n_ph+1
> -            i_ph=i
> -        endif
> -      enddo
> -      if (n_ph.eq.0 .or. (nl.eq.0 .and. nq.eq.0)) then
> -        ! do nothing
> -        do j=1,nexternal
> -          pdg_out(j)=pdg_in(j)
> -          do i=0,4
> -            p_out(i,j)=p_in(i,j)
> -          enddo
> -        enddo
> -        return
> -      elseif (n_ph.eq.1) then
> -        ! do nothing for initial states
> -        do j=1,nincoming
> -          pdg_out(j)=pdg_in(j)
> -          do i=0,4
> -            p_out(i,j)=p_in(i,j)
> -          enddo
> -        enddo
> -        ! find the closest fermion to the photon
> -        ifreco=0
> -        dreco=R
> -        if (i_ph.gt.0) then
> -          do i = nincoming+1, nexternal
> -            if (is_light_charged_fermion(pdg_in(i),nq,nl)) then
> -              dthis=dsqrt(R2_04(p_in(0,i_ph),p_in(0,i)))
> -              if (dthis.le.dreco) then
> -                dreco=dthis
> -                ifreco=i
> -              endif
> -            endif
> -          enddo
> -        endif
> -        if (ifreco.eq.0) then
> -        ! do nothing also for final states
> -          do j=nincoming+1,nexternal
> -            pdg_out(j)=pdg_in(j)
> -            do i=0,4
> -              p_out(i,j)=p_in(i,j)
> -            enddo
> -          enddo
> -        else
> -          times_reco=times_reco+1
> -          skip=0
> -          do j=nincoming+1,nexternal
> -            if (j.ne.i_ph.and.j.ne.ifreco) then
> -              pdg_out(j-skip)=pdg_in(j)
> -              do i=0,4
> -                p_out(i,j-skip)=p_in(i,j)
> -              enddo
> -            elseif (j.eq.ifreco) then
> -              pdg_out(j-skip)=pdg_in(j)
> -              do i=0,3
> -                p_out(i,j-skip)=p_in(i,j)+p_in(i,i_ph)
> -              enddo
> -              p_out(4,j-skip)=p_in(4,j)
> -            elseif (j.eq.i_ph) then
> -              skip=skip+1
> -            endif
> -          enddo
> -        endif
> -      else
> -        write(*,*) 'ERROR, too many photons', n_ph
> -        stop 1
> -      endif
> -
> -      return 
> -      end
> -
> -
> -      logical function is_light_charged_fermion(id, nf, nl)
> -      implicit none
> -      integer id, nf, nl
> -      if (abs(id).le.nf) then
> -          is_light_charged_fermion = .true.
> -      elseif ((abs(id).eq.11.and.nl.ge.1).or.
> -     $        (abs(id).eq.13.and.nl.ge.2).or.
> -     $        (abs(id).eq.15.and.nl.ge.3)) then
> -          is_light_charged_fermion = .true.
> -      else
> -          is_light_charged_fermion = .false.
> -      endif
> -      return
> -      end
> -
> -
> -
> -
> C***************************************************************
> C***************************************************************
> C NO NEED TO CHANGE ANY OF THE FUNCTIONS BELOW
> @@ -1128,3 +984,4 @@
>       end
> 
> 
> +
> 
> === modified file 'Template/NLO/SubProcesses/driver_mintFO.f'
> --- Template/NLO/SubProcesses/driver_mintFO.f	2020-03-26 15:16:08 +0000
> +++ Template/NLO/SubProcesses/driver_mintFO.f	2021-03-24 10:12:56 +0000
> @@ -67,9 +67,9 @@
>       include "timing_variables.inc"
>       real*4 tOther, tTot
> 
> -c applgrid
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c PineAPPL
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> c stats for granny_is_res
>       double precision deravg,derstd,dermax,xi_i_fks_ev_der_max
>      &     ,y_ij_fks_ev_der_max
> @@ -160,10 +160,10 @@
>         stop
>       endif
>       write(*,*) "about to integrate ", ndim,ncalls0,itmax
> -c APPLgrid
> -      if (imode.eq.0) iappl=0 ! overwrite when starting completely fresh
> -      if(iappl.ne.0) then
> -         write(6,*) "Initializing aMCfast ..."
> +c PineAPPL
> +      if (imode.eq.0) pineappl=.False. ! overwrite when starting completely fresh
> +      if(pineappl) then
> +         write(6,*) "Initializing PineAPPL ..."
> c     Set flavor map, starting from all possible
> c     parton lumi configurations defined in initial_states_map.dat
>          call setup_flavourmap
> @@ -365,8 +365,9 @@
>       common/ccalculatedBorn/calculatedBorn
>       character*4      abrv
>       common /to_abrv/ abrv
> -      integer iappl
> -      common /for_applgrid/ iappl
> +c PineAPPL
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       double precision       wgt_ME_born,wgt_ME_real
>       common /c_wgt_ME_tree/ wgt_ME_born,wgt_ME_real
>       integer ini_fin_fks_map(0:2,0:fks_configs)
> @@ -386,9 +387,9 @@
>          write (*,*) 'ERROR ifl not equal to zero in sigint',ifl
>          stop 1
>       endif
> -      if (iappl.ne.0 .and. sum) then
> -         write (*,*) 'WARNING: applgrid only possible '/
> -     &        /'with MC over FKS directories',iappl,sum
> +      if (pineappl .and. sum) then
> +         write (*,*) 'WARNING: PineAPPL only possible '/
> +     &        /'with MC over FKS directories',pineappl,sum
>          write (*,*) 'Switching to MC over FKS directories'
>          sum=.false.
>       endif
> @@ -501,13 +502,13 @@
>          if (do_rwgt_pdf) call reweight_pdf
>       endif
> 
> -      if (iappl.ne.0) then
> +      if (pineappl) then
>          if (sum) then
> -            write (*,*) 'ERROR: applgrid only possible '/
> -     &           /'with MC over FKS directories',iappl,sum
> +            write (*,*) 'ERROR: PineAPPL only possible '/
> +     &           /'with MC over FKS directories',pineappl,sum
>             stop 1
>          endif
> -         call fill_applgrid_weights(vegas_wgt)
> +         call fill_pineappl_weights(vegas_wgt)
>       endif
> 
> c Importance sampling for FKS configurations
> 
> === modified file 'Template/NLO/SubProcesses/driver_mintMC.f'
> --- Template/NLO/SubProcesses/driver_mintMC.f	2020-03-26 15:16:08 +0000
> +++ Template/NLO/SubProcesses/driver_mintMC.f	2021-03-24 10:12:56 +0000
> @@ -134,6 +134,7 @@
>       call printout              !Prints out a summary of paramaters
>       call run_printout          !Prints out a summary of the run settings
>       call initcluster
> +      call check_amp_split 
> c     
> c     Get user input
> c
> 
> === modified file 'Template/NLO/SubProcesses/fks_singular.f'
> --- Template/NLO/SubProcesses/fks_singular.f	2019-09-12 11:04:30 +0000
> +++ Template/NLO/SubProcesses/fks_singular.f	2021-03-24 10:12:56 +0000
> @@ -43,6 +43,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         wgt1=amp_split(iamp)*f_b/g**(qcd_power)
>         call add_wgt(2,orders,wgt1,0d0,0d0)
>       enddo
> @@ -62,6 +63,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         wgt6f1=amp_split_6to5f(iamp)*f_b/g**(qcd_power)
>         wgt6f2=amp_split_6to5f_mur(iamp)*f_b/g**(qcd_power)
>         wgt6f3=amp_split_6to5f_muf(iamp)*f_b/g**(qcd_power)
> @@ -254,6 +256,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         g22=g**(QCD_power)
>         wgt1=amp_split_wgtnstmp(iamp)*f_nb/g22
>         wgt2=amp_split_wgtwnstmpmur(iamp)*f_nb/g22
> @@ -278,6 +281,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         virt_wgt_mint(iamp)=amp_split_virt(iamp)*f_nb
>         born_wgt_mint(iamp)=amp_split_born_for_virt(iamp)*f_nb
>         wgt1=virt_wgt_mint(iamp)/g**(QCD_power)
> @@ -322,6 +326,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         wgt1=amp_split(iamp)*s_ev*f_r/g**(qcd_power)
>         if (sudakov_damp.gt.0d0) then
>           call add_wgt(1,orders,wgt1*sudakov_damp,0d0,0d0)
> @@ -385,6 +390,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         g22=g**(QCD_power)
>         if (replace_MC_subt.gt.0d0) then
>           wgt1=amp_split(iamp)*s_s/g22*replace_MC_subt
> @@ -478,6 +484,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         g22=g**(QCD_power)
>         if (replace_MC_subt.gt.0d0) then
>           wgt1=amp_split(iamp)*s_c/g22*replace_MC_subt
> @@ -587,6 +594,7 @@
>         wgtcpower=0d0
>         if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>         orders_tag=get_orders_tag(orders)
> +        amp_pos=iamp
>         g22=g**(QCD_power)
>         if (replace_MC_subt.gt.0d0) then
>           wgt1=-amp_split(iamp)*s_sc/g22*replace_MC_subt
> @@ -692,6 +700,7 @@
>                 wgtcpower=0d0
>                 if (cpower_pos.gt.0) wgtcpower=dble(orders(cpower_pos))
>                 orders_tag=get_orders_tag(orders)
> +                amp_pos=iamp
>                 g22=g**(QCD_power)
>                 wgt1=sevmc*f_MC_S*xlum_mc_fact*
>      &               amp_split_xmcxsec(iamp,i)/g22
> @@ -980,7 +989,7 @@
>       include 'genps.inc'
>       include 'timing_variables.inc'
>       double precision pi,vegas_wgt
> -      integer i
> +      integer i,j
>       logical firsttime
>       data firsttime /.true./
>       parameter (pi=3.1415926535897932385d0)
> @@ -1002,16 +1011,17 @@
>      &                  fkssymmetryfactorDeg,ngluons,nquarks,nphotons
>       double precision      f_b,f_nb
>       common /factor_nbody/ f_b,f_nb
> -      integer iappl
> -      common /for_applgrid/ iappl
> +      logical pineappl
> +      common /for_pineappl/ pineappl
>       logical needrndec
>       parameter (needrndec=.false.)
>       real*8 ran2
>       external ran2
>       real*8 rndec(10)
>       common/crndec/rndec
> -      include "appl_common.inc" 
> -      !!!include "orders.inc"
> +      include "pineappl_common.inc" 
> +      integer orders(nsplitorders)
> +C
>       call cpu_time(tBefore)
> c Random numbers to be used in the plotting routine: these numbers will
> c not change between events, counter events and n-body contributions.
> @@ -1021,7 +1031,15 @@
>          enddo
>       endif
>       if (firsttime) then
> -         if (iappl.ne.0) appl_amp_split_size = amp_split_size
> +         if (pineappl) then 
> +         ! PineAPPL stuff
> +         appl_amp_split_size = amp_split_size
> +           do j=1,amp_split_size
> +             call amp_split_pos_to_orders(j, orders)
> +             appl_qcdpower(j) = orders(qcd_pos)
> +             appl_qedpower(j) = orders(qed_pos)
> +           enddo
> +         endif
> c Initialize hiostograms for fixed order runs
>          if (fixed_order) call initplot
>          firsttime=.false.
> @@ -1565,6 +1583,7 @@
>       qcdpower(icontr)=QCD_power
>       cpower(icontr)=wgtcpower
>       orderstag(icontr)=orders_tag
> +      amppos(icontr)=amp_pos
>       ipr(icontr)=0
>       call set_pdg(icontr,nFKSprocess)
> 
> @@ -2264,17 +2283,18 @@
>       return
>       end
> 
> -      subroutine fill_applgrid_weights(vegas_wgt)
> -c Fills the ApplGrid weights of appl_common.inc. This subroutine assumes
> +      subroutine fill_pineappl_weights(vegas_wgt)
> +c Fills the FineAPPL weights of pineappl_common.inc. This subroutine assumes
> c that there is an unique PS configuration: at most one Born, one real
> c and one set of counter terms. Among other things, this means that one
> c must do MC over FKS directories.
>       use weight_lines
>       implicit none
>       include 'nexternal.inc'
> -      include 'appl_common.inc'
> +      include 'pineappl_common.inc'
>       include 'nFKSconfigs.inc'
>       include 'genps.inc'
> +      integer orders(nsplitorders)
>       integer i,j 
>       double precision final_state_rescaling,vegas_wgt
>       integer              flavour_map(fks_configs)
> @@ -2284,24 +2304,18 @@
>       common/cproc_combination/iproc_save,eto,etoi,maxproc_found
>       integer lo_qcd_to_amp_pos, nlo_qcd_to_amp_pos
>       integer pos
> -      if (icontr.gt.8) then
> -         write (*,*) 'ERROR: too many applgrid weights. '/
> -     &        /'Should have at most one of each itype.',icontr
> -         stop 1
> -      endif
> -      do j=1,amp_split_size
> -        do i=1,4
> +      do i=1,4
> +        do j=1,amp_split_size
>           appl_w0(i,j)=0d0
>           appl_wR(i,j)=0d0
>           appl_wF(i,j)=0d0
>           appl_wB(i,j)=0d0
> -          appl_x1(i,j)=0d0
> -          appl_x2(i,j)=0d0
> -          appl_QES2(i,j)=0d0
> -          appl_muR2(i,j)=0d0
> -          appl_muF2(i,j)=0d0
> -          appl_qcdpower(i,j) = -1
>         enddo
> +        appl_x1(i)=0d0
> +        appl_x2(i)=0d0
> +        appl_QES2(i)=0d0
> +        appl_muR2(i)=0d0
> +        appl_muF2(i)=0d0
>         appl_flavmap(i)=0
>       enddo
>       appl_event_weight = 0d0
> @@ -2316,62 +2330,63 @@
>          else
>             pos = nlo_qcd_to_amp_pos(qcdpower(i))
>          endif
> +         ! consistency check
> +         if (appl_qcdpower(pos).ne.qcdpower(i)) then
> +           write(*,*) 'ERROR in fill_pineappl_weights, QCDpower',
> +     %        appl_qcdpower(pos), qcdpower(i)  
> +           stop 1
> +         endif
> 
>          if (itype(i).eq.1) then
> c     real
>             appl_w0(1,pos)=appl_w0(1,pos)+wgt(1,i)*final_state_rescaling
> -            appl_qcdpower(1,pos)=qcdpower(i)
> -            appl_x1(1,pos)=bjx(1,i)
> -            appl_x2(1,pos)=bjx(2,i)
> +            appl_x1(1)=bjx(1,i)
> +            appl_x2(1)=bjx(2,i)
>             appl_flavmap(1) = flavour_map(nFKS(i))
> -            appl_QES2(1,pos)=scales2(1,i)
> -            appl_muR2(1,pos)=scales2(2,i)
> -            appl_muF2(1,pos)=scales2(3,i)
> +            appl_QES2(1)=scales2(1,i)
> +            appl_muR2(1)=scales2(2,i)
> +            appl_muF2(1)=scales2(3,i)
>          elseif (itype(i).eq.2) then
> c     born
>             appl_wB(2,pos)=appl_wB(2,pos)+wgt(1,i)*final_state_rescaling
> -            appl_qcdpower(2,pos)=qcdpower(i)
> -            appl_x1(2,pos)=bjx(1,i)
> -            appl_x2(2,pos)=bjx(2,i)
> +            appl_x1(2)=bjx(1,i)
> +            appl_x2(2)=bjx(2,i)
>             appl_flavmap(2) = flavour_map(nFKS(i))
> -            appl_QES2(2,pos)=scales2(1,i)
> -            appl_muR2(2,pos)=scales2(2,i)
> -            appl_muF2(2,pos)=scales2(3,i)
> +            appl_QES2(2)=scales2(1,i)
> +            appl_muR2(2)=scales2(2,i)
> +            appl_muF2(2)=scales2(3,i)
>          elseif (itype(i).eq.3 .or. itype(i).eq.4 .or. itype(i).eq.14
>      &           .or. itype(i).eq.15)then
> c     virtual, soft-virtual or soft-counter
>             appl_w0(2,pos)=appl_w0(2,pos)+wgt(1,i)*final_state_rescaling
>             appl_wR(2,pos)=appl_wR(2,pos)+wgt(2,i)*final_state_rescaling
>             appl_wF(2,pos)=appl_wF(2,pos)+wgt(3,i)*final_state_rescaling
> -            appl_qcdpower(2,pos)=qcdpower(i)
> -            appl_x1(2,pos)=bjx(1,i)
> -            appl_x2(2,pos)=bjx(2,i)
> +            appl_x1(2)=bjx(1,i)
> +            appl_x2(2)=bjx(2,i)
>             appl_flavmap(2) = flavour_map(nFKS(i))
> -            appl_QES2(2,pos)=scales2(1,i)
> -            appl_muR2(2,pos)=scales2(2,i)
> -            appl_muF2(2,pos)=scales2(3,i)
> +            appl_QES2(2)=scales2(1,i)
> +            appl_muR2(2)=scales2(2,i)
> +            appl_muF2(2)=scales2(3,i)
>          elseif (itype(i).eq.5) then
> c     collinear counter            
>             appl_w0(3,pos)=appl_w0(3,pos)+wgt(1,i)*final_state_rescaling
>             appl_wF(3,pos)=appl_wF(3,pos)+wgt(3,i)*final_state_rescaling
> -            appl_qcdpower(3,pos)=qcdpower(i)
> -            appl_x1(3,pos)=bjx(1,i)
> -            appl_x2(3,pos)=bjx(2,i)
> +            appl_x1(3)=bjx(1,i)
> +            appl_x2(3)=bjx(2,i)
>             appl_flavmap(3) = flavour_map(nFKS(i))
> -            appl_QES2(3,pos)=scales2(1,i)
> -            appl_muR2(3,pos)=scales2(2,i)
> -            appl_muF2(3,pos)=scales2(3,i)
> +            appl_QES2(3)=scales2(1,i)
> +            appl_muR2(3)=scales2(2,i)
> +            appl_muF2(3)=scales2(3,i)
>          elseif (itype(i).eq.6) then
> c     soft-collinear counter            
>             appl_w0(4,pos)=appl_w0(4,pos)+wgt(1,i)*final_state_rescaling
>             appl_wF(4,pos)=appl_wF(4,pos)+wgt(3,i)*final_state_rescaling
> -            appl_qcdpower(4,pos)=qcdpower(i)
> -            appl_x1(4,pos)=bjx(1,i)
> -            appl_x2(4,pos)=bjx(2,i)
> +            appl_x1(4)=bjx(1,i)
> +            appl_x2(4)=bjx(2,i)
>             appl_flavmap(4) = flavour_map(nFKS(i))
> -            appl_QES2(4,pos)=scales2(1,i)
> -            appl_muR2(4,pos)=scales2(2,i)
> -            appl_muF2(4,pos)=scales2(3,i)
> +            appl_QES2(4)=scales2(1,i)
> +            appl_muR2(4)=scales2(2,i)
> +            appl_muF2(4)=scales2(3,i)
>          endif
>       enddo
>       return
> @@ -2516,6 +2531,8 @@
>       ! stuff for plotting the different splitorders
>       integer orders_tag_plot
>       common /corderstagplot/ orders_tag_plot
> +      integer amp_pos_plot
> +      common /campposplot/ amp_pos_plot
>       save max_weight
>       call cpu_time(tBefore)
>       if (icontr.eq.0) return
> @@ -2526,12 +2543,27 @@
>          do j=1,iwgt
>             plot_wgts(j,i)=0d0
>          enddo
> +         ! The following if lines have been changed with respect to the
> +         ! usual (with just 3 plot ids: 20, 11 and 12):
> +         !  The kinematics of soft and collinear counterterms may
> +         !  be different, for those processes without soft singularities
> +         !  from initial(final)-state configurations when the 
> +         !  final(initial) confs are integrated (e.g. a a > e+ e-)
> +         !  This gives no problem for normal histogramming (and in
> +         !  fact plot_id 11 13 and 14 are merged into ibody=2 in
> +         !  outfun, but it gives troubles e.g. with applgrid/pineappl. 
> +         !  Note that the separation between soft and soft-virtual
> +         !  may not be needed in reality
>          if (itype(i).eq.2) then
>             plot_id(i)=20 ! Born
>          elseif(itype(i).eq.1) then
>             plot_id(i)=11 ! real-emission
> +         elseif(itype(i).eq.5) then
> +            plot_id(i)=13 ! collinear counter term
> +         elseif(itype(i).eq.6) then
> +            plot_id(i)=14 ! soft collinear counter term
>          else
> -            plot_id(i)=12 ! soft-virtual and counter terms
> +            plot_id(i)=12 ! soft-virtual and soft counter term
>          endif
> c Loop over all previous icontr. If the plot_id, PDGs and momenta are
> c equal to a previous icountr, add the current weight to the plot_wgts
> @@ -2541,12 +2573,12 @@
>          do ii=1,i
>             if (orderstag(ii).ne.orderstag(i)) cycle
>             if (plot_id(ii).ne.plot_id(i)) cycle
> -            if (plot_id(i).eq.20 .or. plot_id(i).eq.12) then
> +            if (plot_id(i).ne.11) then
>                if (.not.pdg_equal(pdg_uborn(1,ii),pdg_uborn(1,i))) cycle
>             else
>                if (.not.pdg_equal(pdg(1,ii),pdg(1,i))) cycle
>             endif
> -            if (plot_id(i).eq.20 .or. plot_id(i).eq.12) then
> +            if (plot_id(i).ne.11) then
>                if (.not.momenta_equal_uborn(momenta(0,1,ii),momenta(0,1
>      $              ,i),fks_j_d(nFKS(ii)),fks_i_d(nFKS(ii))
>      $                 ,fks_j_d(nFKS(i)) ,fks_i_d(nFKS(i)))) cycle
> @@ -2576,6 +2608,7 @@
>             enddo
> c call the analysis/histogramming routines
>             orders_tag_plot=orderstag(i)
> +            amp_pos_plot=amppos(i)
>             call outfun(momenta(0,1,i),y_bst(i),www,pdg(1,i),plot_id(i))
>          endif
>       enddo
> @@ -3130,6 +3163,8 @@
>             endif
>          enddo
>          if (.not. Hevents) then
> +
> +             ! MZ write also orderstag!!
> c For S-events, be careful to take all the IPROC that contribute to the
> c iproc_picked:
>             ipro=eto(etoi(iproc_picked,nFKS(ict)),nFKS(ict))
> @@ -3167,6 +3202,7 @@
>      &              //trim(adjustl(procid))
> 
>                write (str_temp,30)
> +     &              orderstag(ict),
>      &              QCDpower(ict),
>      &              (bjx(j,ict),j=1,2),
>      &              (scales2(j,ict),j=1,3),
> @@ -3218,6 +3254,7 @@
>      &           //trim(adjustl(procid))
> 
>             write (str_temp,30)
> +     &           orderstag(ict),
>      &           QCDpower(ict),
>      &           (bjx(j,ict),j=1,2),
>      &           (scales2(j,ict),j=1,3),
> @@ -3238,7 +3275,7 @@
>          endif
>       enddo
>       return
> - 30   format(i2,6(1x,d14.8),6(1x,i2),1x,i8,1x,d18.12,1x,d18.12)
> + 30   format(i15,i2,6(1x,d14.8),6(1x,i2),1x,i8,1x,d18.12,1x,d18.12)
>       end
> 
> 
> @@ -5877,22 +5914,19 @@
>             tOLP=tOLP+(tAfter-tBefore)
>             virtual_over_born=virt_wgt/born_wgt
>             if (ickkw.ne.-1) then
> -               if (use_poly_virtual) then
> -                  virt_wgt=virt_wgt-polyfit(0)*born_wgt
> -               else
> -                  virt_wgt=virt_wgt-average_virtual(0,ichan)*born_wgt
> -               endif
> +               virt_wgt = 0d0
>                do iamp=1,amp_split_size
>                   if (amp_split_virt(iamp).eq.0d0) cycle
>                   if (use_poly_virtual) then
>                      amp_split_virt(iamp)=amp_split_virt(iamp)-
>      $                    polyfit(iamp)
>      $                    *amp_split_born_for_virt(iamp)
> -               else
> -                  amp_split_virt(iamp)=amp_split_virt(iamp)-
> -     $                 average_virtual(iamp,ichan)
> -     $                 *amp_split_born_for_virt(iamp)
> +                  else
> +                     amp_split_virt(iamp)=amp_split_virt(iamp)-
> +     $                    average_virtual(iamp,ichan)
> +     $                     *amp_split_born_for_virt(iamp)
>                   endif
> +                  virt_wgt = virt_wgt + amp_split_virt(iamp)
>                enddo
>             endif
>             if (abrv.ne.'virt') then
> 
> === modified file 'Template/NLO/SubProcesses/handling_lhe_events.f'
> --- Template/NLO/SubProcesses/handling_lhe_events.f	2019-12-11 10:31:48 +0000
> +++ Template/NLO/SubProcesses/handling_lhe_events.f	2021-03-24 10:12:56 +0000
> @@ -21,6 +21,9 @@
>       character*80 muR_id_str,muF1_id_str,muF2_id_str,QES_id_str
>       common/cscales_id_string/muR_id_str,muF1_id_str,
>      #                         muF2_id_str,QES_id_str
> +      integer n_orderstags,oo,tag
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> c
>       write(ifile,'(a)')
>      #     '<LesHouchesEvents version="3.0">'
> @@ -30,28 +33,38 @@
>          write(ifile,'(a)') '  <initrwgt>'
>          idwgt=1000
>          if (do_rwgt_scale) then
> -            do kk=1,dyn_scale(0)
> -               write(ifile,'(a,i4,a)') 
> -     &              "    <weightgroup name='scale_variation ",
> -     &              dyn_scale(kk),"' combine='envelope'>"
> -               if (lscalevar(kk)) then
> -                  do ii=1,nint(scalevarF(0))
> -                     do jj=1,nint(scalevarR(0))
> -                        idwgt=idwgt+1
> -                        write(ifile,'(a,i4,a,i4,a,e11.5,a,e11.5,a)')
> -     $                       "      <weight id='",idwgt,"'> dyn=",
> -     $                       dyn_scale(kk)," muR=",scalevarR(jj)," muF="
> +            do oo=0,n_orderstags
> +               if (oo.eq.0) then
> +                   tag = 0
> +               else
> +                   tag = orderstags_glob(oo)
> +               endif
> +               do kk=1,dyn_scale(0)
> +                  write(ifile,'(a,i15,i4,a)') 
> +     &                 "    <weightgroup name='scale_variation ",
> +     &                 tag, dyn_scale(kk),"' combine='envelope'>"
> +                  if (lscalevar(kk)) then
> +                     do ii=1,nint(scalevarF(0))
> +                        do jj=1,nint(scalevarR(0))
> +                           idwgt=idwgt+1
> +                           write(ifile,
> +     $                           '(a,i4,a,i15,a,i4,a,e11.5,a,e11.5,a)')
> +     $                       "      <weight id='",idwgt,"'> tag=" ,tag,
> +     $                       " dyn=",dyn_scale(kk),
> +     $                       " muR=",scalevarR(jj)," muF="
>      $                       ,scalevarF(ii)," </weight>"
> +                        enddo
>                      enddo
> -                  enddo
> -               else
> -                  idwgt=idwgt+1
> -                  write(ifile,'(a,i4,a,i4,a,e11.5,a,e11.5,a)')
> -     $                 "      <weight id='",idwgt,"'> dyn=",
> -     $                 dyn_scale(kk)," muR=",1d0 ," muF=",1d0
> -     $                 ," </weight>"
> -               endif
> -               write(ifile,'(a)') "    </weightgroup>"
> +                  else
> +                     idwgt=idwgt+1
> +                     write(ifile,'(a,i4,a,i15,a,i4,a,e11.5,a,e11.5,a)')
> +     $                       "      <weight id='",idwgt,"'> tag=" ,tag,
> +     $                       " dyn=",dyn_scale(kk),
> +     $                       " muR=",1d0 ," muF=",1d0
> +     $                       ," </weight>"
> +                  endif
> +                  write(ifile,'(a)') "    </weightgroup>"
> +               enddo
>             enddo
>          endif
>          if (do_rwgt_pdf) then
> @@ -113,7 +126,7 @@
>       include './cuts.inc'
>       integer lhaid
>       character*20 pdlabel
> -      integer iappl
> +      logical pineappl
>       character*7 event_norm
>       character*13 temp
> c     other parameter
> @@ -126,6 +139,9 @@
>       character*150 buffer,buffer_lc,buffer2
>       integer event_id
>       common /c_event_id/ event_id
> +      integer n_orderstags,oo,tag
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> 
> c     Set the event_id to 0. If 0 or positive, this value will be update
> c     in write_lhe_event. It is set to -99 through a block data
> @@ -215,28 +231,38 @@
>          write(ifile,'(a)') '  <initrwgt>'
>          idwgt=1000
>          if (do_rwgt_scale) then
> -            do kk=1,dyn_scale(0)
> -               write(ifile,'(a,i4,a)') 
> -     &              "    <weightgroup name='scale_variation ",
> -     &              dyn_scale(kk),"' combine='envelope'>"
> -               if (lscalevar(kk)) then
> -                  do ii=1,nint(scalevarF(0))
> -                     do jj=1,nint(scalevarR(0))
> -                        idwgt=idwgt+1
> -                        write(ifile,'(a,i4,a,i4,a,e11.5,a,e11.5,a)')
> -     $                       "      <weight id='",idwgt,"'> dyn=",
> -     $                       dyn_scale(kk)," muR=",scalevarR(jj)," muF="
> +            do oo=0,n_orderstags
> +               if (oo.eq.0) then
> +                   tag = 0
> +               else
> +                   tag = orderstags_glob(oo)
> +               endif
> +               do kk=1,dyn_scale(0)
> +                  write(ifile,'(a,i15,i4,a)') 
> +     &                 "    <weightgroup name='scale_variation ",
> +     &                 tag, dyn_scale(kk),"' combine='envelope'>"
> +                  if (lscalevar(kk)) then
> +                     do ii=1,nint(scalevarF(0))
> +                        do jj=1,nint(scalevarR(0))
> +                           idwgt=idwgt+1
> +                           write(ifile,
> +     $                           '(a,i4,a,i15,a,i4,a,e11.5,a,e11.5,a)')
> +     $                       "      <weight id='",idwgt,"'> tag=" ,tag,
> +     $                       " dyn=",dyn_scale(kk),
> +     $                       " muR=",scalevarR(jj)," muF="
>      $                       ,scalevarF(ii)," </weight>"
> +                        enddo
>                      enddo
> -                  enddo
> -               else
> -                  idwgt=idwgt+1
> -                  write(ifile,'(a,i4,a,i4,a,e11.5,a,e11.5,a)')
> -     $                 "      <weight id='",idwgt,"'> dyn=",
> -     $                 dyn_scale(kk)," muR=",1d0 ," muF=",1d0
> -     $                 ," </weight>"
> -               endif
> -               write(ifile,'(a)') "    </weightgroup>"
> +                  else
> +                     idwgt=idwgt+1
> +                     write(ifile,'(a,i4,a,i15,a,i4,a,e11.5,a,e11.5,a)')
> +     $                       "      <weight id='",idwgt,"'> tag=" ,tag,
> +     $                       " dyn=",dyn_scale(kk),
> +     $                       " muR=",1d0 ," muF=",1d0
> +     $                       ," </weight>"
> +                  endif
> +                  write(ifile,'(a)') "    </weightgroup>"
> +               enddo
>             enddo
>          endif
>          if (do_rwgt_pdf) then
> @@ -648,7 +674,7 @@
>       DOUBLE PRECISION XWGTUP,SCALUP,AQEDUP,AQCDUP,
>      # PUP(5,*),VTIMUP(*),SPINUP(*)
>       character*140 buff
> -      integer ifile,i,kk
> +      integer ifile,i,kk,oo
>       character*9 ch1
>       integer isorh_lhe,ifks_lhe,jfks_lhe,fksfather_lhe,ipartner_lhe
>       double precision scale1_lhe,scale2_lhe
> @@ -662,6 +688,9 @@
>       common/event_attributes/nattr,npNLO,npLO
>       include './run.inc'
>       include 'unlops.inc'
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> c     if event_id is zero or positive (that means that there was a call
> c     to write_lhef_header_banner) update it and write it
> c RF: don't use the event_id:
> @@ -761,20 +790,23 @@
>                write(ifile,'(a)') '  <rwgt>'
>                idwgt=1000
>                if (do_rwgt_scale) then
> -                  do kk=1,dyn_scale(0)
> -                     if (lscalevar(kk)) then
> -                        do i=1,nint(scalevarF(0))
> -                           do j=1,nint(scalevarR(0))
> -                              idwgt=idwgt+1
> -                              write(ifile,601) "   <wgt id='",idwgt,"'>"
> -     $                             ,wgtxsecmu(j,i,kk)," </wgt>"
> +                  do oo=0,n_orderstags
> +                     do kk=1,dyn_scale(0)
> +                        if (lscalevar(kk)) then
> +                           do i=1,nint(scalevarF(0))
> +                              do j=1,nint(scalevarR(0))
> +                                 idwgt=idwgt+1
> +                                 write(ifile,601) 
> +     $                                "   <wgt id='",idwgt,"'>"
> +     $                                ,wgtxsecmu(oo,j,i,kk)," </wgt>"
> +                              enddo
>                            enddo
> -                        enddo
> -                     else
> -                        idwgt=idwgt+1
> -                        write(ifile,601) "   <wgt id='",idwgt,"'>"
> -     $                       ,wgtxsecmu(1,1,kk)," </wgt>"
> -                     endif
> +                        else
> +                           idwgt=idwgt+1
> +                           write(ifile,601) "   <wgt id='",idwgt,"'>"
> +     $                          ,wgtxsecmu(oo,1,1,kk)," </wgt>"
> +                        endif
> +                     enddo
>                   enddo
>                endif
>                if (do_rwgt_pdf) then
> @@ -806,7 +838,7 @@
>  441  format(4(1x,e16.10))
>  442  format(1x,e16.10,2(1x,e14.8))
>  503  format(1x,i2,1x,i6,4(1x,e14.8))
> - 504  format(1x,i8,1x,i2,4(1x,i4),5(1x,e14.8),2(1x,e10.4))
> + 504  format(1x,i8,1x,i2,4(1x,i4),5(1x,e24.17),2(1x,e10.4))
>  601  format(a12,i4,a2,1x,e11.5,a7)
> c
>       return
> @@ -821,7 +853,7 @@
>       INTEGER NUP,IDPRUP,IDUP(*),ISTUP(*),MOTHUP(2,*),ICOLUP(2,*)
>       DOUBLE PRECISION XWGTUP,SCALUP,AQEDUP,AQCDUP,
>      # PUP(5,*),VTIMUP(*),SPINUP(*)
> -      integer ifile,i,kk
> +      integer ifile,i,kk,oo
>       character*140 buff
>       character*80 string
>       character*12 dummy12
> @@ -835,6 +867,9 @@
>       common/c_i_process/i_process
>       integer nattr,npNLO,npLO
>       common/event_attributes/nattr,npNLO,npLO
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
>       include 'unlops.inc'
>       include 'run.inc'
> c
> @@ -910,18 +945,20 @@
>                read(ifile,'(a)')string
>                wgtref=XWGTUP
>                if (do_rwgt_scale) then
> -                  do kk=1,dyn_scale(0)
> -                     if (lscalevar(kk)) then
> -                        do i=1,nint(scalevarF(0))
> -                           do j=1,nint(scalevarR(0))
> -                              call read_rwgt_line(ifile,idwgt
> -     $                             ,wgtxsecmu(j,i,kk))
> +                  do oo=0,n_orderstags
> +                     do kk=1,dyn_scale(0)
> +                        if (lscalevar(kk)) then
> +                           do i=1,nint(scalevarF(0))
> +                              do j=1,nint(scalevarR(0))
> +                                 call read_rwgt_line(ifile,idwgt
> +     $                                ,wgtxsecmu(oo,j,i,kk))
> +                              enddo
>                            enddo
> -                        enddo
> -                     else
> -                        call read_rwgt_line(ifile,idwgt,wgtxsecmu(1,1
> +                        else
> +                           call read_rwgt_line(ifile,idwgt,wgtxsecmu(oo,1,1
>      $                       ,kk))
> -                     endif
> +                        endif
> +                     enddo
>                   enddo
>                endif
>                if (do_rwgt_pdf) then
> @@ -968,7 +1005,7 @@
>       INTEGER NUP,IDPRUP,IDUP(*),ISTUP(*),MOTHUP(2,*),ICOLUP(2,*)
>       DOUBLE PRECISION XWGTUP,SCALUP,AQEDUP,AQCDUP,
>      # PUP(5,*),VTIMUP(*),SPINUP(*)
> -      integer ifile,i,kk
> +      integer ifile,i,kk,oo
>       character*140 buff
>       character*80 string
>       character*12 dummy12
> @@ -982,6 +1019,9 @@
>       common/c_i_process/i_process
>       integer nattr,npNLO,npLO
>       common/event_attributes/nattr,npNLO,npLO
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
>       include 'unlops.inc'
>       include 'run.inc'
> c
> @@ -1066,18 +1106,20 @@
>                read(ifile,'(a)')string
>                wgtref=XWGTUP
>                if (do_rwgt_scale) then
> -                  do kk=1,dyn_scale(0)
> -                     if (lscalevar(kk)) then
> -                        do i=1,nint(scalevarF(0))
> -                           do j=1,nint(scalevarR(0))
> -                              call read_rwgt_line(ifile,idwgt
> -     $                             ,wgtxsecmu(j,i,kk))
> +                  do oo=0,n_orderstags
> +                     do kk=1,dyn_scale(0)
> +                        if (lscalevar(kk)) then
> +                           do i=1,nint(scalevarF(0))
> +                              do j=1,nint(scalevarR(0))
> +                                 call read_rwgt_line(ifile,idwgt
> +     $                                ,wgtxsecmu(oo,j,i,kk))
> +                              enddo
>                            enddo
> -                        enddo
> -                     else
> -                        call read_rwgt_line(ifile,idwgt,wgtxsecmu(1,1
> +                        else
> +                           call read_rwgt_line(ifile,idwgt,wgtxsecmu(oo,1,1
>      $                       ,kk))
> -                     endif
> +                        endif
> +                     enddo
>                   enddo
>                endif
>                if (do_rwgt_pdf) then
> 
> === modified file 'Template/NLO/SubProcesses/iproc_map.f'
> --- Template/NLO/SubProcesses/iproc_map.f	2017-07-31 08:48:20 +0000
> +++ Template/NLO/SubProcesses/iproc_map.f	2021-03-24 10:12:56 +0000
> @@ -205,7 +205,7 @@
> 
> ************************************************************************
> *     The following routine sets up the flavour map that needs to be
> -*     feeded to APPLgrid in the initialization stage.
> +*     feeded to PineAPPL in the initialization stage.
> ************************************************************************
>       subroutine setup_flavourmap
> *
> @@ -215,8 +215,8 @@
>       include 'nexternal.inc'
>       include 'genps.inc'
>       include "leshouche_decl.inc"
> -      include "reweight_appl.inc"
> -      include "appl_common.inc"
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> *
>       character*200 buffer
>       integer procnum,i,l,j,ll,found_a,found_m
> @@ -251,8 +251,18 @@
> *     Read the file using a buffer
>       do
>          read (71,'(a)',err=100,end=100) buffer ! Jump to line 100 when all lines read
> +         write(*,*) buffer
>          read (buffer,*) kpdflumi,nproc(kpdflumi),
>      1        ((pdgs(i,j,kpdflumi),i=1,2),j=1,nproc(kpdflumi))
> +         ! check that the allocated arrays are big enough
> +         if (kpdflumi.gt.mxpdflumi) then
> +            write(*,*) 'ERROR in iproc_map.f, too many processes'
> +            write(*,*) 'increase mxpdflumi and max_nproc' //
> +     %                 ' inside appl_comon.inc'
> +            write(*,*) 'and __max_nproc__ in pineappl_interface.cc'
> +            write(*,*) 'Make sure to assign all variables the same value!'
> +            stop 1
> +         endif
>          appl_nproc(kpdflumi) = nproc(kpdflumi)
>       enddo
>  100  continue
> 
> === modified file 'Template/NLO/SubProcesses/madfks_plot.f'
> --- Template/NLO/SubProcesses/madfks_plot.f	2018-12-21 15:27:32 +0000
> +++ Template/NLO/SubProcesses/madfks_plot.f	2021-03-24 10:12:56 +0000
> @@ -11,9 +11,9 @@
>       double precision xsecScale_acc(maxscales,maxscales,maxdynscales)
>      $     ,xsecPDFr_acc(0:maxPDFs,maxPDFsets)
>       common /scale_pdf_print/xsecScale_acc,xsecPDFr_acc
> -      integer iappl
> -      common /for_applgrid/ iappl
> -      include "appl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      include "pineappl_common.inc"
>       nwgt=1
>       if (.not.allocated(weights_info)) allocate(weights_info(1))
>       weights_info(nwgt)="central value               "
> @@ -109,7 +109,7 @@
> c start with central member of the first set
>          call InitPDFm(1,0)
>       endif
> -      if(iappl.ne.0)then
> +      if(pineappl)then
> c Initialize grid parameters to negative values.
>          appl_Q2min   = -1d0
>          appl_Q2max   = -1d0
> @@ -159,14 +159,14 @@
>       double precision xsecScale_acc(maxscales,maxscales,maxdynscales)
>      $     ,xsecPDFr_acc(0:maxPDFs,maxPDFsets)
>       common /scale_pdf_print/xsecScale_acc,xsecPDFr_acc
> -      integer iappl
> -      common /for_applgrid/ iappl
> -      include "appl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      include "pineappl_common.inc"
> c
>       xnorm=1.d0/float(ncalls0)
>       if(useitmax)xnorm=xnorm/float(itmax)
> -c Normalization factor for the APPLgrid grids
> -      if(iappl.ne.0) appl_norm_histo = 1d0 / dble(ncalls0*itmax)
> +c Normalization factor for the PineAPPL grids
> +      if(pineappl) appl_norm_histo = 1d0 / dble(ncalls0*itmax)
>       call analysis_end(xnorm)
> c Write the accumulated results to a file
>       open (unit=34,file='scale_pdf_dependence.dat',status='unknown')
> @@ -242,13 +242,17 @@
>       double precision xsecScale_acc(maxscales,maxscales,maxdynscales)
>      $     ,xsecPDFr_acc(0:maxPDFs,maxPDFsets)
>       common /scale_pdf_print/xsecScale_acc,xsecPDFr_acc
> -      integer iappl
> -      common /for_applgrid/ iappl
> -      include "appl_common.inc"
> -c Born, n-body or (n+1)-body contribution:
> +      integer amp_pos_plot
> +      common /campposplot/ amp_pos_plot
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      include "pineappl_common.inc"
> +c Born, n-body or (n+1)-body contribution. For more information
> +C  about itype, see the comments about plot_id inside
> +C  the fill_plot subroutine of fks_singular.f
>       if(itype.eq.11) then
>          ibody=1 ! (n+1)-body
> -      elseif(itype.eq.12)then
> +      elseif(itype.ge.12 .and. itype.le.14)then
>          ibody=2 ! n-body
>       elseif(itype.eq.20)then
>          ibody=3 ! Born
> @@ -275,11 +279,31 @@
>          enddo
>          p(4,i)=pmass(i)
>       enddo
> -      if(iappl.ne.0)then
> -         appl_itype     = ibody
> +      if(pineappl)then
> +         appl_itype = ibody
> +         if(ibody.eq.2)then
> +c      special treatment for collinear
> +c      and soft collinear counterterms
> +c      (see comments inside the fill_plots subroutine)
> +           if(itype.eq.13)then
> +            !collinear counterterm
> +             appl_itype = 4
> +           elseif(itype.eq.14)then
> +            !solf-collinear counterterm
> +             appl_itype = 5
> +           endif
> +         endif
> +         appl_amp_pos   = amp_pos_plot
>          appl_www_histo = www(1)
>       endif
>       call analysis_fill(p,istatus,ipdg,www,ibody)
> +      if(pineappl)then
> +        ! this call is necessary since PineAPPL
> +        ! already combine the different contributions
> +        ! with the same kinematics, while histograms
> +        ! are filled contribution by contribution.
> +        call APPL_delete_itype
> +      endif
> c Fill the accumulated results
>       i_wgt=1
>       if (do_rwgt_scale) then
> 
> === modified file 'Template/NLO/SubProcesses/makefile'
> --- Template/NLO/SubProcesses/makefile	2018-08-27 14:51:23 +0000
> +++ Template/NLO/SubProcesses/makefile	2021-03-24 10:12:56 +0000
> @@ -8,7 +8,7 @@
> READ40=read40.o
> 
> # Files to collect all the events in the separate integration channels into a single file
> -COLLECT_EVENTS=collect_events.o handling_lhe_events.o fill_MC_mshell.o
> +COLLECT_EVENTS=collect_events.o handling_lhe_events.o fill_MC_mshell.o orderstags_glob.o
> 
> %.o : %.f
> 	$(FC) $(FFLAGS) -c -I. -I$(LIBDIR) $<
> 
> === modified file 'Template/NLO/SubProcesses/makefile_fks_dir'
> --- Template/NLO/SubProcesses/makefile_fks_dir	2019-08-26 12:25:59 +0000
> +++ Template/NLO/SubProcesses/makefile_fks_dir	2021-03-24 10:12:56 +0000
> @@ -25,17 +25,19 @@
> $(LIBDIR)libpdf.a $(LIBDIR)libcernlib.a
> 
> # Files for all executables
> -FILES= $(patsubst %.f,%.o,$(wildcard parton_lum_*.f)) $(patsubst	\
> -	%.f,%.o,$(wildcard matrix_*.f)) FKSParams.o real_me_chooser.o	\
> -	chooser_functions.o genps_fks.o setcuts.o setscales.o		\
> -	veto_xsec.o $(patsubst %.f,%.o,$(wildcard b_sf_???.f))		\
> -	born.o sborn_sf.o extra_cnt_wrapper.o $(patsubst		\
> -	%.f,%.o,$(wildcard born_cnt_*.f)) fks_Sij.o			\
> -	$(fastjetfortran_madfks) fks_singular.o montecarlocounter.o	\
> -	reweight_xsec.o boostwdir2.o initcluster.o cluster.o		\
> -	splitorders_stuff.o reweight.o get_color.o 			\
> -	iproc_map.o MC_integer.o $(reweight_xsec_events_pdf_dummy)	\
> -	$(applgrid_interface) weight_lines.o mint_module.o polfit.o
> +FILES= $(patsubst %.f,%.o,$(wildcard parton_lum_*.f)) 			\
> +	 $(patsubst %.f,%.o,$(wildcard matrix_*.f)) 			\
> +	 FKSParams.o real_me_chooser.o chooser_functions.o recmom.o	\
> +	 genps_fks.o setcuts.o setscales.o veto_xsec.o		 	\
> +	 $(patsubst %.f,%.o,$(wildcard b_sf_???.f)) 			\
> +	 born.o sborn_sf.o extra_cnt_wrapper.o				\
> +	 $(patsubst %.f,%.o,$(wildcard born_cnt_*.f))			\
> +	 fks_Sij.o $(fastjetfortran_madfks) fks_singular.o		\
> +	 montecarlocounter.o reweight_xsec.o boostwdir2.o       	\
> +	 initcluster.o cluster.o splitorders_stuff.o 			\
> +	 reweight.o get_color.o iproc_map.o				\
> +	 MC_integer.o $(reweight_xsec_events_pdf_dummy)			\
> +	 $(pineappl_interface) weight_lines.o mint_module.o polfit.o
> 
> # Files needed for mintFO & mintMC
> RUN= $(FO_ANALYSE) $(FILES) cuts.o pythia_unlops.o recluster.o 		\
> @@ -58,13 +60,13 @@
> SYM= $(RUN) BinothLHADummy.o symmetry_fks_v3.o write_ajob.o
> 
> # Files for event reweighting to get e.g. scale and PDF uncertainties
> -RWGFILES=reweight_xsec_events.o handling_lhe_events.o			\
> +RWGFILES=reweight_xsec_events.o handling_lhe_events.o recmom.o 		\
> 	$(patsubst %.f,%.o,$(wildcard parton_lum_*.f)) setscales.o	\
> 	cuts.o $(fastjetfortran_madfks) boostwdir2.o veto_xsec.o	\
> 	$(reweight_xsec_events_pdf_dummy) fill_MC_mshell.o cluster.o	\
> 	reweight.o get_color.o iproc_map.o chooser_functions.o 		\
> 	pythia_unlops.o recluster.o splitorders_stuff.o reweight_xsec.o \
> -	weight_lines.o
> +	weight_lines.o orderstags_glob.o
> 
> %.o: %.f
> 	$(FC) $(FFLAGS) -c -I. -I$(LIBDIR) $<
> @@ -86,17 +88,17 @@
> 	$(CXX) $(CXXFLAGS) -c -I. -I$(ANADIR) $(FO_INCLUDEPATHS) $^
> 
> gensym: $(SYM)
> -	$(FC) $(LDFLAGS) -o gensym $(SYM) $(APPLLIBS) $(LINKLIBS) $(FJLIBS)
> +	$(FC) $(LDFLAGS) -o gensym $(SYM) $(APPLLIBS) $(LINKLIBS) $(FO_EXTRAPATHS) $(FO_EXTRALIBS) $(FJLIBS)
> 	rm fks_singular.o
> 	strip gensym
> 
> test_soft_col_limits: $(TEST)
> -	$(FC) $(LDFLAGS) -o test_soft_col_limits $(TEST) $(APPLLIBS) $(LINKLIBS) $(FJLIBS)
> +	$(FC) $(LDFLAGS) -o test_soft_col_limits $(TEST) $(APPLLIBS) $(LINKLIBS) $(FO_EXTRAPATHS) $(FO_EXTRALIBS) $(FJLIBS)
> 	rm test_soft_col_limits.o
> 	strip test_soft_col_limits
> 
> check_poles: $(POLES) $(libmadloop)
> -	$(FC) -o check_poles $(POLES) $(NLOLIBS) $(APPLLIBS) $(LINKLIBS) $(FJLIBS) $(LDFLAGS)
> +	$(FC) -o check_poles $(POLES) $(NLOLIBS) $(APPLLIBS) $(LINKLIBS) $(FJLIBS) $(FO_EXTRAPATHS) $(FO_EXTRALIBS) $(LDFLAGS)
> 	strip check_poles
> 
> madevent_mintMC: $(MINTMC) $(libmadloop) makefile $(LIBS)
> 
> === modified file 'Template/NLO/SubProcesses/open_output_files.f'
> --- Template/NLO/SubProcesses/open_output_files.f	2015-03-05 16:12:37 +0000
> +++ Template/NLO/SubProcesses/open_output_files.f	2021-03-24 10:12:56 +0000
> @@ -32,6 +32,18 @@
>       subroutine HwU_write_file
>       implicit none
>       double precision xnorm
> +c     PineAPPL commons (this may not be the best place to put it)
> +      include "reweight_pineappl.inc"
> +      include "pineappl_common.inc"
> +      logical pineappl
> +      common /for_pineappl/ pineappl
> +      integer j
> +      if(pineappl)then
> +         do j=1,nh_obs
> +           appl_obs_num = j
> +           call APPL_term
> +         enddo
> +      endif
>       open (unit=99,file='MADatNLO.HwU',status='unknown')
>       xnorm=1d0
>       call HwU_output(99,xnorm)
> 
> === added file 'Template/NLO/SubProcesses/orderstags_glob.f'
> --- Template/NLO/SubProcesses/orderstags_glob.f	1970-01-01 00:00:00 +0000
> +++ Template/NLO/SubProcesses/orderstags_glob.f	2021-03-24 10:12:56 +0000
> @@ -0,0 +1,41 @@
> +      subroutine get_orderstags_glob_infos()
> +      use extra_weights
> +      implicit none
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> +      integer j
> +
> +      open(unit=78,file="orderstags_glob.dat",status="old",err=101)
> +      goto 99
> +101   open(unit=78,file="../orderstags_glob.dat",status="old",err=101)
> +
> +99    read(78,*) n_orderstags
> +      write(*,*) 'get_orderstags_glob_infos: n_orderstags=', n_orderstags 
> +      read(78,*) (orderstags_glob(j), j=1, n_orderstags)
> +      write(*,*) 'get_orderstags_glob_infos: orderstags_glob',
> +     $             (orderstags_glob(j), j=1, n_orderstags)
> +      return
> +      end
> +
> +
> +      integer function get_orderstags_glob_pos(tag)
> +      use extra_weights
> +      implicit none
> +      integer tag
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> +      integer j
> +
> +      do j = 1, n_orderstags
> +         if (orderstags_glob(j).eq.tag) then
> +             get_orderstags_glob_pos = j
> +             return
> +          endif
> +      enddo
> +      write(*,*) 'ERROR, get_orderstags_glob_pos, not found', tag
> +      stop 1
> +      return
> +      end
> +        
> 
> === renamed file 'Template/NLO/SubProcesses/appl_common.inc' => 'Template/NLO/SubProcesses/pineappl_common.inc'
> --- Template/NLO/SubProcesses/appl_common.inc	2016-02-10 14:18:55 +0000
> +++ Template/NLO/SubProcesses/pineappl_common.inc	2021-03-24 10:12:56 +0000
> @@ -1,37 +1,36 @@
> *     -*-fortran-*-
> ************************************************************************
> *     NLO mode of aMC@NLO
> +*     Common blocks needed for the PineAPPL interface
> ************************************************************************
>       include 'orders.inc'
> *     Amp split size
>       integer appl_amp_split_size 
> -      common / appl_common_fixed / appl_amp_split_size
> +      integer appl_qcdpower(amp_split_size), appl_qedpower(amp_split_size)
> +      common / appl_common_fixed / appl_amp_split_size, appl_qcdpower, appl_qedpower
> 
> *     Initial state map to be used together with the info in appl_flavmap
>       integer appl_nlumi
> -      integer mxpdflumi
> -      integer max_nproc
> -      parameter(mxpdflumi=121,max_nproc=121)
> +      include 'pineappl_maxproc.inc'
>       integer appl_nproc(mxpdflumi)
>       integer appl_lumimap(2,max_nproc,mxpdflumi)
>       common / appl_common_lumi / appl_lumimap,appl_nproc,appl_nlumi
> 
> *     Event weights, kinematics, observables etc. that are different event by event
> -      double precision appl_x1(4, amp_split_size), 
> -     1                 appl_x2(4, amp_split_size)
> -      double precision appl_muF2(4, amp_split_size),
> -     1                 appl_muR2(4, amp_split_size),
> -     2                 appl_QES2(4, amp_split_size)
> +      double precision appl_x1(4), 
> +     1                 appl_x2(4)
> +      double precision appl_muF2(4),
> +     1                 appl_muR2(4),
> +     2                 appl_QES2(4)
>       double precision appl_w0(4, amp_split_size),
>      1                 appl_wR(4, amp_split_size),
>      2                 appl_wF(4, amp_split_size),
>      3                 appl_wB(4, amp_split_size)
> -      integer appl_qcdpower(4, amp_split_size)
>       integer appl_flavmap(4)
>       common / appl_common_weights / appl_x1,appl_x2,
>      1                               appl_muF2,appl_muR2,appl_QES2,
>      2                               appl_w0,appl_wR,appl_wF,appl_wB,
> -     3                               appl_flavmap,appl_qcdpower
> +     3                               appl_flavmap
> 
> *     Parameters of the grids.
> *     These parameters can optionally be singularly specified by the user,
> @@ -52,6 +51,7 @@
>       double precision appl_obs_bins(0:100)
>       integer appl_obs_nbins
>       integer appl_itype
> +      integer appl_amp_pos
>       integer appl_obs_num
>       common / appl_common_histokin / appl_www_histo,appl_norm_histo,
>      1                                appl_obs_histo,
> @@ -59,10 +59,11 @@
>      3                                appl_obs_bins,
>      4                                appl_obs_nbins,
>      5                                appl_itype,
> +     5                                appl_amp_pos,
>      6                                appl_obs_num
> 
> *     This is the actual hadronic event weight, computed with the LHAPDF set
> -*     defined above, needed for checks in the C++ applgrid interface
> +*     defined above, needed for checks in the C++ pineappl interface
> *     Save also the vegas weight, needed to fill histograms and for checks
> *     appl_www_histo is the same weight used to will the amcatnlo
> *     histograms in the madfks routine
> 
> === renamed file 'Template/NLO/SubProcesses/appl_interface.cc' => 'Template/NLO/SubProcesses/pineappl_interface.cc'
> --- Template/NLO/SubProcesses/appl_interface.cc	2014-07-01 08:21:03 +0000
> +++ Template/NLO/SubProcesses/pineappl_interface.cc	2021-03-24 10:12:56 +0000
> @@ -1,45 +1,401 @@
> +#include <algorithm>
> +#include <cassert>
> +#include <cmath>
> +#include <cstddef>
> +#include <cstdio>
> +#include <cstdlib>
> +#include <iomanip>
> #include <iostream>
> -#include <stdlib.h>
> +#include <iterator>
> +#include <sstream>
> +#include <string>
> +#include <vector>
> +
> +#include <pineappl_capi.h>
> +
> +#include "orders.h"
> +
> +#include "pineappl_maxproc.h"
> 
> /*
>   fNLO mode of aMCatNLO
> */
> 
> -void (*appl_initptr)() = 0;
> -void (*appl_fillptr)() = 0;
> -void (*appl_fillrefptr)() = 0;
> -void (*appl_fillrefoutptr)() = 0;
> -void (*appl_recoptr)() = 0;
> -void (*appl_termptr)() = 0;
> -
> -extern "C" void appl_init_() {
> -  // std::cerr<<"I am in appl_init (C++ version)"<<std::endl;
> -  if (appl_initptr) appl_initptr(); 
> -}
> -
> -extern "C" void appl_fill_() {
> -  //std::cerr<<"I am in appl_fill (C++ version)"<<std::endl;
> -  if (appl_fillptr) appl_fillptr(); 
> -}
> -
> -extern "C" void appl_fill_ref_() {
> -  //std::cerr<<"I am in appl_fill_ref (C++ version)"<<std::endl;
> -  if (appl_fillrefptr) appl_fillrefptr(); 
> -}
> -
> -extern "C" void appl_fill_ref_out_() {
> -  // std::cerr<<"I am in appl_fill_ref_out (C++ version)"<<std::endl;
> -  if (appl_fillrefoutptr) appl_fillrefoutptr(); 
> -}
> -
> -extern "C" void appl_reco_() {
> -  // std::cerr<<"I am in appl_reco (C++ version)"<<std::endl;
> -  if (appl_recoptr) appl_recoptr(); 
> -}
> -
> -extern "C" void appl_term_() {
> -  //std::cerr<<"I am in appl_term (C++ version)"<<std::endl;
> -  if (appl_termptr) appl_termptr();  
> -}
> -
> -
> +// Declare grids
> +std::vector<pineappl_grid*> grid_obs;
> +
> +// translates an index from the range [0, __amp_split_size) to the indices need by `fill_grid`
> +std::vector<std::vector<int>> translation_tables;
> +
> +// Information defined at the generation (configuration) step, that does
> +// not vary event by event
> +extern "C" struct
> +{
> +    int amp_split_size; // Maximum number of coupling-combinations
> +    int qcdpower[__amp_split_size]; // Power of alpha_s for each amp_split
> +    int qedpower[__amp_split_size]; // Power of alpha for each amp_split
> +} appl_common_fixed_;
> +
> +// Map of the PDF combinations from aMC@NLO - structure for each
> +// "subprocess" i, has some number nproc[i] pairs of parton
> +// combinations. To be used together with the info in appl_flavmap.
> +extern "C" struct
> +{
> +    int lumimap[__max_nproc__][__max_nproc__][2]; // (paired) subprocesses per combination
> +    int nproc[__max_nproc__]; // number of separate (pairwise) subprocesses for this combination
> +    int nlumi; // overall number of combinations ( 0 < nlumi <= __mxpdflumi__ )
> +} appl_common_lumi_;
> +
> +// Event weights, kinematics, etc. that are different event by event
> +extern "C" struct
> +{
> +    double x1[4], x2[4];
> +    double muF2[4], muR2[4], muQES2[4];
> +    double W0[__amp_split_size][4], WR[__amp_split_size][4];
> +    double WF[__amp_split_size][4], WB[__amp_split_size][4];
> +    int flavmap[4];
> +} appl_common_weights_;
> +
> +// Parameters of the grids.
> +// These parameters can optionally be singularly specified by the user,
> +// but if no specification is given, the code will use the default values.
> +extern "C" struct
> +{
> +    double Q2min, Q2max;
> +    double xmin, xmax;
> +    int nQ2, Q2order;
> +    int nx, xorder;
> +} appl_common_grid_;
> +
> +// Parameters of the histograms
> +extern "C" struct
> +{
> +    double www_histo, norm_histo;
> +    double obs_histo;
> +    double obs_min, obs_max;
> +    double obs_bins[101];
> +    int obs_nbins;
> +    int itype_histo;
> +    int amp_pos;
> +    int obs_num;
> +} appl_common_histokin_;
> +
> +// Event weight and cross section
> +extern "C" struct
> +{
> +    double event_weight, vegaswgt;
> +    double xsec12, xsec11, xsec20;
> +} appl_common_reco_;
> +
> +extern "C" struct
> +{
> +    int idbmup[2];
> +    double ebmup[2];
> +    int pdfgup[2];
> +    int pdfsup[2];
> +    int idwtup;
> +    int nprup;
> +    double xsecup[100];
> +    double xerrup[100];
> +    double xmaxup[100];
> +    int lprup[100];
> +} heprup_;
> +
> +extern "C" void appl_init_()
> +{
> +    // Grid Initialization and definition of the observables.
> +    // Construct the input file name according to its position in the
> +    // vector "grid_obs".
> +    std::size_t const index = grid_obs.size();
> +
> +    int lo_power = 9999;
> +    int nlo_power = 0;
> +
> +    for (int i = 0; i != appl_common_fixed_.amp_split_size; ++i)
> +    {
> +        int sum = appl_common_fixed_.qcdpower[i] + appl_common_fixed_.qedpower[i];
> +
> +        lo_power = std::min(lo_power, sum);
> +        nlo_power = std::max(nlo_power, sum);
> +    }
> +
> +    // TODO: are there any situations is which there are NLOs but no LOs?
> +
> +    // we assume that there is always at least one LO, and zero or one NLO
> +    assert((nlo_power == (lo_power + 2)) || (nlo_power == lo_power));
> +
> +    std::vector<uint32_t> subgrid_params;
> +
> +    translation_tables.emplace_back();
> +    translation_tables.back().reserve(appl_common_fixed_.amp_split_size);
> +
> +    for (int i = 0; i != appl_common_fixed_.amp_split_size; ++i)
> +    {
> +        int const qcd = appl_common_fixed_.qcdpower[i];
> +        int const qed = appl_common_fixed_.qedpower[i];
> +        int const sum = qcd + qed;
> +
> +        translation_tables.back().push_back(subgrid_params.size() / 4);
> +
> +        if (sum == lo_power)
> +        {
> +            // WB
> +            subgrid_params.insert(subgrid_params.end(), { qcd / 2, qed / 2, 0, 0 });
> +        }
> +        else if (sum == nlo_power)
> +        {
> +            // W0
> +            subgrid_params.insert(subgrid_params.end(), { qcd / 2, qed / 2, 0, 0 });
> +            // WR
> +            subgrid_params.insert(subgrid_params.end(), { qcd / 2, qed / 2, 1, 0 });
> +            // WF
> +            subgrid_params.insert(subgrid_params.end(), { qcd / 2, qed / 2, 0, 1 });
> +        }
> +    }
> +
> +    // Define the settings for the interpolation in x and Q2.
> +    // These are common to all the grids computed.
> +    // If values larger than zero (i.e. set by the user) are found the default
> +    // settings are replaced with the new ones.
> +    auto* key_vals = pineappl_keyval_new();
> +
> +    if (appl_common_grid_.nQ2 > 0)
> +    {
> +        pineappl_keyval_set_int(key_vals, "nq2", appl_common_grid_.nQ2);
> +    }
> +    // Max and min value of Q2
> +    if (appl_common_grid_.Q2min > 0.0)
> +    {
> +        pineappl_keyval_set_double(key_vals, "q2min", appl_common_grid_.Q2min);
> +    }
> +    if (appl_common_grid_.Q2max > 0.0)
> +    {
> +        pineappl_keyval_set_double(key_vals, "q2max", appl_common_grid_.Q2max);
> +    }
> +    // Order of the polynomial interpolation in Q2
> +    if (appl_common_grid_.Q2order > 0)
> +    {
> +        pineappl_keyval_set_int(key_vals, "q2order", appl_common_grid_.Q2order);
> +    }
> +    // Number of points for the x interpolation
> +    if (appl_common_grid_.nx > 0)
> +    {
> +        pineappl_keyval_set_int(key_vals, "nx", appl_common_grid_.nx);
> +    }
> +    // Min and max value of x
> +    if (appl_common_grid_.xmin > 0.0)
> +    {
> +        pineappl_keyval_set_double(key_vals, "xmin", appl_common_grid_.xmin);
> +    }
> +    if (appl_common_grid_.xmax > 0.0)
> +    {
> +        pineappl_keyval_set_double(key_vals, "xmax", appl_common_grid_.xmax);
> +    }
> +    // Order of the polynomial interpolation in x
> +    if (appl_common_grid_.xorder > 0)
> +    {
> +        pineappl_keyval_set_int(key_vals, "xorder", appl_common_grid_.xorder);
> +    }
> +
> +    // Set up the PDF luminosities
> +    auto* lumi = pineappl_lumi_new();
> +
> +    // Loop over parton luminosities
> +    for (int ilumi = 0; ilumi < appl_common_lumi_.nlumi; ilumi++)
> +    {
> +        int nproc = appl_common_lumi_.nproc[ilumi];
> +
> +        std::vector<int32_t> pdg_ids;
> +        pdg_ids.reserve(2 * nproc);
> +
> +        for (int iproc = 0; iproc != nproc; ++iproc)
> +        {
> +            pdg_ids.push_back(appl_common_lumi_.lumimap[ilumi][iproc][0]);
> +            pdg_ids.push_back(appl_common_lumi_.lumimap[ilumi][iproc][1]);
> +        }
> +
> +        pineappl_lumi_add(lumi, nproc, pdg_ids.data(), nullptr);
> +    }
> +
> +    // Use the reweighting function
> +    pineappl_keyval_set_bool(key_vals, "reweight", true);
> +
> +    // valid choices are: "LagrangeSubgrid", "NtupleSubgrid"
> +    pineappl_keyval_set_string(key_vals, "subgrid_type", "LagrangeSubgrid");
> +
> +    // set PDG ids of the initial states
> +    pineappl_keyval_set_string(key_vals, "initial_state_1",
> +        std::to_string(heprup_.idbmup[0]).c_str());
> +    pineappl_keyval_set_string(key_vals, "initial_state_2",
> +        std::to_string(heprup_.idbmup[1]).c_str());
> +
> +    // Create a grid with the binning given in the "obsbins[Nbins+1]" array
> +    grid_obs.push_back(pineappl_grid_new(
> +        lumi,
> +        subgrid_params.size() / 4,
> +        subgrid_params.data(),
> +        appl_common_histokin_.obs_nbins,
> +        appl_common_histokin_.obs_bins,
> +        key_vals
> +    ));
> +
> +    pineappl_keyval_delete(key_vals);
> +    pineappl_lumi_delete(lumi);
> +}
> +
> +extern "C" void appl_delete_itype_()
> +{
> +    // Check that itype ranges from 1 to 5.
> +    int itype = appl_common_histokin_.itype_histo;
> +    if ((itype < 1) || (itype > 5))
> +    {
> +        std::cout << "amcblast ERROR: Invalid value of itype = " << itype << std::endl;
> +        std::exit(-10);
> +    }
> +
> +    // this is the second index of the WB/R/F/0 arrays
> +    int index = appl_common_histokin_.amp_pos - 1;
> +
> +    // aMC@NLO weights. Four grids, ordered as {W0,WR,WF,WB}.
> +    double(&W0)[4] = appl_common_weights_.W0[index];
> +    double(&WR)[4] = appl_common_weights_.WR[index];
> +    double(&WF)[4] = appl_common_weights_.WF[index];
> +    double(&WB)[4] = appl_common_weights_.WB[index];
> +
> +    int k;
> +
> +    switch (itype)
> +    {
> +    case 1:
> +        k = 0;
> +        break;
> +
> +    case 2:
> +    case 3:
> +        k = 1;
> +        break;
> +
> +    case 4:
> +        k = 2;
> +        break;
> +
> +    case 5:
> +        k = 3;
> +        break;
> +
> +    default:
> +        assert( false );
> +    }
> +
> +    W0[k] = 0.0;
> +    WR[k] = 0.0;
> +    WF[k] = 0.0;
> +    WB[k] = 0.0;
> +}
> +
> +extern "C" void appl_fill_()
> +{
> +    // Check that itype ranges from 1 to 5.
> +    int itype = appl_common_histokin_.itype_histo;
> +    if ((itype < 1) || (itype > 5))
> +    {
> +        std::cout << "amcblast ERROR: Invalid value of itype = " << itype << std::endl;
> +        std::exit(-10);
> +    }
> +
> +    // this is the second index of the WB/R/F/0 arrays
> +    int index = appl_common_histokin_.amp_pos - 1;
> +
> +    // aMC@NLO weights. Four grids, ordered as {W0,WR,WF,WB}.
> +    double(&W0)[4] = appl_common_weights_.W0[index];
> +    double(&WR)[4] = appl_common_weights_.WR[index];
> +    double(&WF)[4] = appl_common_weights_.WF[index];
> +    double(&WB)[4] = appl_common_weights_.WB[index];
> +
> +    int nlumi = appl_common_lumi_.nlumi;
> +    double ttol = 1e-100;
> +    double obs = appl_common_histokin_.obs_histo;
> +
> +    // Histogram number
> +    int nh = appl_common_histokin_.obs_num - 1;
> +
> +    // translate (index,nh) -> index of the PineAPPL grid
> +    int const grid_index = translation_tables.at(nh).at(index);
> +
> +    int k;
> +
> +    switch (itype)
> +    {
> +    case 1:
> +        k = 0;
> +        break;
> +
> +    case 2:
> +    case 3:
> +        k = 1;
> +        break;
> +
> +    case 4:
> +        k = 2;
> +        break;
> +
> +    case 5:
> +        k = 3;
> +        break;
> +
> +    default:
> +        assert( false );
> +    }
> +
> +    double const x1 = appl_common_weights_.x1[k];
> +    double const x2 = appl_common_weights_.x2[k];
> +    double const scale2 = appl_common_weights_.muF2[k];
> +    int const ilumi = appl_common_weights_.flavmap[k] - 1;
> +
> +    if (x1 < 0.0 || x1 > 1.0 || x2 < 0.0 || x2 > 1.0)
> +    {
> +        std::cout << "amcblast ERROR: Invalid value of x1 and/or x2 = " << x1 << " " << x2
> +                  << std::endl;
> +        std::exit(-10);
> +    }
> +
> +    if (x1 == 0.0 && x2 == 0.0)
> +    {
> +        return;
> +    }
> +
> +    if (std::fabs(W0[k]) > ttol)
> +    {
> +        pineappl_grid_fill(grid_obs[nh], x1, x2, scale2, grid_index + 0, obs, ilumi, W0[k]);
> +    }
> +
> +    if (std::fabs(WR[k]) > ttol)
> +    {
> +        pineappl_grid_fill(grid_obs[nh], x1, x2, scale2, grid_index + 1, obs, ilumi, WR[k]);
> +    }
> +
> +    if (std::fabs(WF[k]) > ttol)
> +    {
> +        pineappl_grid_fill(grid_obs[nh], x1, x2, scale2, grid_index + 2, obs, ilumi, WF[k]);
> +    }
> +
> +    if (std::fabs(WB[k]) > ttol)
> +    {
> +        pineappl_grid_fill(grid_obs[nh], x1, x2, scale2, grid_index, obs, ilumi, WB[k]);
> +    }
> +}
> +
> +extern "C" void appl_term_()
> +{
> +    // Histogram number
> +    int const nh = appl_common_histokin_.obs_num - 1;
> +
> +    // convert between gs^2 and alphas, and normalize the grid by (hbarc)^2 and the number of runs
> +    pineappl_grid_scale_by_order(grid_obs[nh], 4.0 * std::acos(-1.0), 1.0, 1.0, 1.0,
> +        389379660.0 * appl_common_histokin_.norm_histo);
> +
> +    // Write grid to file
> +    pineappl_grid_write(grid_obs[nh], ("grid_obs_" + std::to_string(nh) + "_out.pineappl").c_str());
> +
> +    pineappl_grid_delete(grid_obs[nh]);
> +}
> 
> === renamed file 'Template/NLO/SubProcesses/appl_interface_dummy.f' => 'Template/NLO/SubProcesses/pineappl_interface_dummy.f'
> --- Template/NLO/SubProcesses/appl_interface_dummy.f	2014-06-26 08:45:41 +0000
> +++ Template/NLO/SubProcesses/pineappl_interface_dummy.f	2021-03-24 10:12:56 +0000
> @@ -5,20 +5,6 @@
>       return
>       end
> c
> -      subroutine APPL_fill_ref_out
> -      implicit none
> -      write(6,*) "You should not be here in APPL_fill dummy!"
> -      stop
> -      return
> -      end
> -c
> -      subroutine APPL_fill_ref
> -      implicit none
> -      write(6,*) "You should not be here in APPL_fill dummy!"
> -      stop
> -      return
> -      end
> -c
>       subroutine APPL_init
>       implicit none
>       write(6,*) "You should not be here in APPL_init dummy!"
> @@ -26,6 +12,13 @@
>       return
>       end
> c
> +      subroutine APPL_delete_itype
> +      implicit none
> +      write(6,*) "You should not be here in APPL_init dummy!"
> +      stop
> +      return
> +      end
> +c
>       subroutine APPL_term
>       implicit none
>       write(6,*) "You should not be here in APPL_term dummy!"
> 
> === added file 'Template/NLO/SubProcesses/recmom.f'
> --- Template/NLO/SubProcesses/recmom.f	1970-01-01 00:00:00 +0000
> +++ Template/NLO/SubProcesses/recmom.f	2021-03-24 10:12:56 +0000
> @@ -0,0 +1,139 @@
> +      subroutine recombine_momenta(R, etaph, reco_l, reco_q, p_in, pdg_in, p_out, pdg_out)
> +      implicit none
> +      ! recombine photons with the closest fermion if the distance is
> +      ! less than R and if the rapidity of photons is < etaph (etaph < 0
> +      ! means no cut). Output a new set of momenta and pdgs corresponding
> +      ! to the recombined particles. If recombination occurs the photon
> +      ! disappears from the output particles
> +      ! arguments
> +      include 'nexternal.inc'
> +      double precision R, etaph, p_in(0:4,nexternal), p_out(0:4,nexternal)
> +      logical reco_l, reco_q
> +      integer pdg_in(nexternal), pdg_out(nexternal)
> +      ! local variables
> +      integer nq, nl
> +      integer id_ph
> +      parameter (id_ph=22)
> +      integer n_ph, i_ph
> +      integer i,j
> +      integer ifreco
> +      double precision dreco, dthis
> +      integer skip
> +      logical is_light_charged_fermion
> +      double precision R2, eta
> +      ! 
> +      integer times_reco
> +      common/to_times_reco/ times_reco
> +      ! reset everything
> +      do j=1,nexternal
> +        pdg_out(j)=0
> +        do i=0,4
> +          p_out(i,j)=0d0
> +        enddo
> +      enddo
> +
> +      ! check if we want to recombine with leptons
> +      if (reco_l) then
> +          nl = 3
> +      else 
> +          nl = 0
> +      endif
> +
> +      ! check if we want to recombine with quarks
> +      if (reco_q) then
> +          nq = 5
> +      else 
> +          nq = 0
> +      endif
> +
> +      ! count the photons
> +      n_ph=0
> +      do i=nincoming+1, nexternal
> +        if (pdg_in(i).eq.id_ph.and.
> +     $   (abs(eta(p_in(0,i))).lt.etaph.or.etaph.lt.0d0)) then
> +            n_ph=n_ph+1
> +            i_ph=i
> +        endif
> +      enddo
> +      if (n_ph.eq.0 .or. (nl.eq.0 .and. nq.eq.0)) then
> +        ! do nothing
> +        do j=1,nexternal
> +          pdg_out(j)=pdg_in(j)
> +          do i=0,4
> +            p_out(i,j)=p_in(i,j)
> +          enddo
> +        enddo
> +        return
> +      elseif (n_ph.eq.1) then
> +        ! do nothing for initial states
> +        do j=1,nincoming
> +          pdg_out(j)=pdg_in(j)
> +          do i=0,4
> +            p_out(i,j)=p_in(i,j)
> +          enddo
> +        enddo
> +        ! find the closest fermion to the photon
> +        ifreco=0
> +        dreco=R
> +        if (i_ph.gt.0) then
> +          do i = nincoming+1, nexternal
> +            if (is_light_charged_fermion(pdg_in(i),nq,nl)) then
> +              dthis=dsqrt(R2(p_in(0,i_ph),p_in(0,i)))
> +              if (dthis.le.dreco) then
> +                dreco=dthis
> +                ifreco=i
> +              endif
> +            endif
> +          enddo
> +        endif
> +        if (ifreco.eq.0) then
> +        ! do nothing also for final states
> +          do j=nincoming+1,nexternal
> +            pdg_out(j)=pdg_in(j)
> +            do i=0,4
> +              p_out(i,j)=p_in(i,j)
> +            enddo
> +          enddo
> +        else
> +          times_reco=times_reco+1
> +          skip=0
> +          do j=nincoming+1,nexternal
> +            if (j.ne.i_ph.and.j.ne.ifreco) then
> +              pdg_out(j-skip)=pdg_in(j)
> +              do i=0,4
> +                p_out(i,j-skip)=p_in(i,j)
> +              enddo
> +            elseif (j.eq.ifreco) then
> +              pdg_out(j-skip)=pdg_in(j)
> +              do i=0,3
> +                p_out(i,j-skip)=p_in(i,j)+p_in(i,i_ph)
> +              enddo
> +              p_out(4,j-skip)=p_in(4,j)
> +            elseif (j.eq.i_ph) then
> +              skip=skip+1
> +            endif
> +          enddo
> +        endif
> +      else
> +        write(*,*) 'ERROR, too many photons', n_ph
> +        stop 1
> +      endif
> +
> +      return 
> +      end
> +
> +
> +      logical function is_light_charged_fermion(id, nf, nl)
> +      implicit none
> +      integer id, nf, nl
> +      if (abs(id).le.nf) then
> +          is_light_charged_fermion = .true.
> +      elseif ((abs(id).eq.11.and.nl.ge.1).or.
> +     $        (abs(id).eq.13.and.nl.ge.2).or.
> +     $        (abs(id).eq.15.and.nl.ge.3)) then
> +          is_light_charged_fermion = .true.
> +      else
> +          is_light_charged_fermion = .false.
> +      endif
> +      return
> +      end
> 
> === renamed file 'Template/NLO/SubProcesses/reweight_appl.inc' => 'Template/NLO/SubProcesses/reweight_pineappl.inc'
> --- Template/NLO/SubProcesses/reweight_appl.inc	2014-06-26 08:45:41 +0000
> +++ Template/NLO/SubProcesses/reweight_pineappl.inc	2021-03-24 10:12:56 +0000
> @@ -1,5 +1,5 @@
> c Common blocks for NLO or aMC@NLO reweighting
> -c USed only for interfacing with applgrid
> +c Used only for interfacing with APPLgrid/PineAPPL
> c Conventions for array relevant to NLO computations:
> c   i=1,2,3,4  -> event, soft, collinear, soft-collinear
> c   ==>  i = icountevts+2 for counterevents
> 
> === modified file 'Template/NLO/SubProcesses/reweight_xsec_events.f'
> --- Template/NLO/SubProcesses/reweight_xsec_events.f	2017-09-28 15:13:09 +0000
> +++ Template/NLO/SubProcesses/reweight_xsec_events.f	2021-03-24 10:12:56 +0000
> @@ -8,7 +8,7 @@
>       use extra_weights
>       implicit none
>       include "run.inc"
> -      integer i,ii,jj,kk,isave,lef,ifile,maxevt,iSorH_lhe,ifks_lhe
> +      integer i,oo,ii,jj,kk,isave,lef,ifile,maxevt,iSorH_lhe,ifks_lhe
>      $     ,jfks_lhe,fksfather_lhe,ipartner_lhe,kwgtinfo,kexternal
>      $     ,jwgtnumpartn,ofile,kf,kr,n,nn
>       double precision scale1_lhe,scale2_lhe,wgtcentral,wgtmumin
> @@ -28,6 +28,10 @@
>       character*7         pdlabel,epa_label
>       integer       lhaid
>       common/to_pdf/lhaid,pdlabel,epa_label
> +c Common blocks for the orders tags
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> c Les Houches Event File info:
>       integer IDBMUP(2),PDFGUP(2),PDFSUP(2),IDWTUP,NPRUP,LPRUP
>       double precision EBMUP(2),XSECUP,XERRUP,XMAXUP
> @@ -154,6 +158,8 @@
> 
>       rewind(34)
> 
> +      call get_orderstags_glob_infos()
> +
>       ofile=35
>       open(unit=ofile,file=fname1,status='unknown')
> 
> @@ -217,17 +223,19 @@
> c renormalize all the scale & PDF weights to have the same normalization
> c as XWGTUP
>          if(do_rwgt_scale)then
> -            do kk=1,dyn_scale(0)
> -               if (lscalevar(kk)) then
> -                  do ii=1,nint(scalevarF(0))
> -                     do jj=1,nint(scalevarR(0))
> -                        wgtxsecmu(jj,ii,kk)=
> -     &                       wgtxsecmu(jj,ii,kk)/wgtref*XWGTUP
> +            do oo=0,n_orderstags
> +               do kk=1,dyn_scale(0)
> +                  if (lscalevar(kk)) then
> +                     do ii=1,nint(scalevarF(0))
> +                        do jj=1,nint(scalevarR(0))
> +                           wgtxsecmu(oo,jj,ii,kk)=
> +     &                          wgtxsecmu(oo,jj,ii,kk)/wgtref*XWGTUP
> +                        enddo
>                      enddo
> -                  enddo
> -               else
> -                  wgtxsecmu(1,1,kk)=wgtxsecmu(1,1,kk)/wgtref*XWGTUP
> -               endif
> +                  else
> +                     wgtxsecmu(oo,1,1,kk)=wgtxsecmu(oo,1,1,kk)/wgtref*XWGTUP
> +                  endif
> +               enddo
>             enddo
>          endif
>          if (do_rwgt_pdf) then
> @@ -243,19 +251,21 @@
>          endif
> 
> c Keep track of the accumulated results:
> +C  put in xsecScale_acc only the 0th entry of wgtxsecmu, ie
> +C  the entry inclusive on the various orderstag
>          if (do_rwgt_scale) then
>             do kk=1,dyn_scale(0)
>                if (lscalevar(kk)) then
>                   do ii=1,nint(scalevarF(0))
>                      do jj=1,nint(scalevarR(0))
>                         xsecScale_acc(jj,ii,kk)=xsecScale_acc(jj,ii,kk)
> -     $                       +wgtxsecmu(jj,ii,kk)
> +     $                       +wgtxsecmu(0,jj,ii,kk)
> 
>                      enddo
>                   enddo
>                else
>                   xsecScale_acc(1,1,kk)=xsecScale_acc(1,1,kk)
> -     $                 +wgtxsecmu(1,1,kk)
> +     $                 +wgtxsecmu(0,1,1,kk)
>                endif
>             enddo
>          endif
> @@ -393,7 +403,7 @@
>       do i=1,icontr
>          write(*,*)n_ctr_str(i)
>          read(n_ctr_str(i),*)(wgt(j,i),j=1,3),(wgt_ME_tree(j,i),j=1,2)
> -     &        ,idum,(pdg(j,i),j=1,nexternal),QCDpower(i),(bjx(j,i),j=1
> +     &        ,idum,(pdg(j,i),j=1,nexternal),orderstag(i),QCDpower(i),(bjx(j,i),j=1
>      &        ,2),(scales2(j,i),j=1,3),g_strong(i),(momenta_conf(j),j=1
>      &        ,2),itype(i),nFKS(i),idum,idum,idum,wgts(1,i),bias_wgt(i)
>          do ii=1,2
> @@ -418,53 +428,68 @@
>       implicit none
>       include 'nexternal.inc'
>       include 'run.inc'
> +      include 'orders.inc'
>       integer i,pd,lp,iwgt_save,kr,kf,dd
>       double precision mu2_f(maxscales),mu2_r(maxscales),xlum(maxscales)
>      $     ,pdg2pdf,mu2_q,rwgt_muR_dep_fac,g(maxscales),alphas,pi
>      $     ,c_mu2_r,c_mu2_f
>       parameter (pi=3.14159265358979323846d0)
>       external pdg2pdf,rwgt_muR_dep_fac,alphas
> +      integer orderstag_this, iamp
> +      integer get_orders_tag_from_amp_pos
> +      external get_orders_tag_from_amp_pos
> +
>       iwgt_save=iwgt
>       do i=1,icontr
>          iwgt=iwgt_save
>          mu2_q=scales2(1,i)
> -         do dd=1,dyn_scale(0)
> -            call set_mu_central(i,dd,c_mu2_r,c_mu2_f)
> -            do kr=1,nint(scalevarR(0))
> -               if ((.not. lscalevar(dd)) .and. kr.ne.1) exit
> -               mu2_r(kr)=c_mu2_r*scalevarR(kr)**2
> -c Update the strong coupling
> -               g(kr)=sqrt(4d0*pi*alphas(sqrt(mu2_r(kr))))
> -            enddo
> -            do kf=1,nint(scalevarF(0))
> -               if ((.not. lscalevar(dd)) .and. kf.ne.1) exit
> -               mu2_f(kf)=c_mu2_f*scalevarF(kf)**2
> -c call the PDFs
> -               xlum(kf)=1d0
> -               LP=SIGN(1,LPP(1))
> -               pd=pdg(1,i)
> -               if (pd.eq.21) pd=0
> -               xlum(kf)=xlum(kf)*PDG2PDF(ABS(LPP(1)),pd*LP,bjx(1,i)
> -     &              ,DSQRT(mu2_f(kf)))
> -               LP=SIGN(1,LPP(2))
> -               pd=pdg(2,i)
> -               if (pd.eq.21) pd=0
> -               xlum(kf)=xlum(kf)*PDG2PDF(ABS(LPP(2)),pd*LP,bjx(2,i)
> -     &              ,DSQRT(mu2_f(kf)))
> -            enddo
> -            do kf=1,nint(scalevarF(0))
> -               if ((.not. lscalevar(dd)) .and. kf.ne.1) exit
> +
> +         do iamp=0, amp_split_size
> +            ! loop over the various coupling combinations.
> +            ! iamp=0 just keeps everything
> +            if (iamp.ne.0) orderstag_this = get_orders_tag_from_amp_pos(iamp)
> +            ! filter the weights with the correct order
> +            if (iamp.ne.0.and.orderstag_this.ne.orderstag(i)) cycle
> +
> +            do dd=1,dyn_scale(0)
> +               call set_mu_central(i,dd,c_mu2_r,c_mu2_f)
>                do kr=1,nint(scalevarR(0))
>                   if ((.not. lscalevar(dd)) .and. kr.ne.1) exit
> -                  iwgt=iwgt+1   ! increment the iwgt for the wgts() array
> -                  call weight_lines_allocated(nexternal,max_contr,iwgt
> -     $                 ,max_iproc)
> +                  mu2_r(kr)=c_mu2_r*scalevarR(kr)**2
> +c Update the strong coupling
> +                  g(kr)=sqrt(4d0*pi*alphas(sqrt(mu2_r(kr))))
> +               enddo
> +               do kf=1,nint(scalevarF(0))
> +                  if ((.not. lscalevar(dd)) .and. kf.ne.1) exit
> +                  mu2_f(kf)=c_mu2_f*scalevarF(kf)**2
> +c call the PDFs
> +                  xlum(kf)=1d0
> +                  LP=SIGN(1,LPP(1))
> +                  pd=pdg(1,i)
> +                  if (pd.eq.21) pd=0
> +                  xlum(kf)=xlum(kf)*PDG2PDF(ABS(LPP(1)),pd*LP,bjx(1,i)
> +     &                 ,DSQRT(mu2_f(kf)))
> +                  LP=SIGN(1,LPP(2))
> +                  pd=pdg(2,i)
> +                  if (pd.eq.21) pd=0
> +                  xlum(kf)=xlum(kf)*PDG2PDF(ABS(LPP(2)),pd*LP,bjx(2,i)
> +     &                 ,DSQRT(mu2_f(kf)))
> +               enddo
> +
> +               do kf=1,nint(scalevarF(0))
> +                  if ((.not. lscalevar(dd)) .and. kf.ne.1) exit
> +                  do kr=1,nint(scalevarR(0))
> +                     if ((.not. lscalevar(dd)) .and. kr.ne.1) exit
> +                     iwgt=iwgt+1   ! increment the iwgt for the wgts() array
> +                     call weight_lines_allocated(nexternal,max_contr,iwgt
> +     $                   ,max_iproc)
> c add the weights to the array
> -                  wgts(iwgt,i)=xlum(kf) * (wgt(1,i)+wgt(2,i)
> -     $                 *log(mu2_r(kr)/mu2_q)+wgt(3,i)*log(mu2_f(kf)
> -     $                 /mu2_q))*g(kr)**QCDpower(i)
> -                  wgts(iwgt,i)=wgts(iwgt,i)*rwgt_muR_dep_fac(
> +                     wgts(iwgt,i)=xlum(kf) * (wgt(1,i)+wgt(2,i)
> +     $                   *log(mu2_r(kr)/mu2_q)+wgt(3,i)*log(mu2_f(kf)
> +     $                   /mu2_q))*g(kr)**QCDpower(i)
> +                     wgts(iwgt,i)=wgts(iwgt,i)*rwgt_muR_dep_fac(
>      &                          sqrt(mu2_r(kr)),sqrt(scales2(2,i)))
> +                  enddo
>                enddo
>             enddo
>          enddo
> @@ -530,17 +555,24 @@
>       implicit none
>       include 'nexternal.inc'
>       include 'run.inc'
> -      integer ii,jj,kk,nn,n,iw,i
> -      do kk=1,dyn_scale(0)
> -         if (lscalevar(kk)) then
> -            do ii=1,nint(scalevarF(0))
> -               do jj=1,nint(scalevarR(0))
> -                  wgtxsecmu(jj,ii,kk)=0d0
> +      integer ii,jj,kk,oo,nn,n,iw,i
> +      integer orderstag_this
> +      integer n_orderstags
> +      integer orderstags_glob(maxorders)
> +      common /c_orderstags_glob/n_orderstags, orderstags_glob
> +
> +      do oo=0,n_orderstags
> +         do kk=1,dyn_scale(0)
> +            if (lscalevar(kk)) then
> +               do ii=1,nint(scalevarF(0))
> +                  do jj=1,nint(scalevarR(0))
> +                     wgtxsecmu(oo,jj,ii,kk)=0d0
> +                  enddo
>                enddo
> -            enddo
> -         else
> -            wgtxsecmu(1,1,kk)=0d0
> -         endif
> +            else
> +               wgtxsecmu(oo,1,1,kk)=0d0
> +            endif
> +        enddo
>       enddo
>       do nn=1,lhaPDFid(0)
>          if (lpdfvar(nn)) then
> @@ -554,18 +586,23 @@
>       do i=1,icontr
>          iw=2
>          if (do_rwgt_scale) then
> -            do kk=1,dyn_scale(0)
> -               if (lscalevar(kk)) then
> -                  do ii=1,nint(scalevarF(0))
> -                     do jj=1,nint(scalevarR(0))
> -                        wgtxsecmu(jj,ii,kk)=wgtxsecmu(jj,ii,kk)+wgts(iw,i)
> -                        iw=iw+1
> +            do oo=0,n_orderstags
> +               if (oo.ne.0) orderstag_this = orderstags_glob(oo)
> +               ! filter the weights with the correct order
> +               if (oo.ne.0.and.orderstag_this.ne.orderstag(i)) cycle
> +               do kk=1,dyn_scale(0)
> +                  if (lscalevar(kk)) then
> +                     do ii=1,nint(scalevarF(0))
> +                        do jj=1,nint(scalevarR(0))
> +                           wgtxsecmu(oo,jj,ii,kk)=wgtxsecmu(oo,jj,ii,kk)+wgts(iw,i)
> +                           iw=iw+1
> +                        enddo
>                      enddo
> -                  enddo
> -               else
> -                  wgtxsecmu(1,1,kk)=wgtxsecmu(1,1,kk)+wgts(iw,i)
> -                  iw=iw+1
> -               endif
> +                  else
> +                     wgtxsecmu(oo,1,1,kk)=wgtxsecmu(oo,1,1,kk)+wgts(iw,i)
> +                     iw=iw+1
> +                  endif
> +               enddo
>             enddo
>          endif
>          if (do_rwgt_pdf) then
> 
> === modified file 'Template/NLO/SubProcesses/setcuts.f'
> --- Template/NLO/SubProcesses/setcuts.f	2018-12-21 15:27:32 +0000
> +++ Template/NLO/SubProcesses/setcuts.f	2021-03-24 10:12:56 +0000
> @@ -403,7 +403,6 @@
>                      else
>                         smin_update = dsqrt(smin_update)/nb_iden_pdg ! share over N particle, and change dimension
>                      endif
> -                     smin_update = emass(i)
>                      ! update in sqrt(s) so take the 
>                      if  (j_fks.gt.nincoming) then
>                         taumin(iFKS,ichan)=taumin(iFKS,ichan) + smin_update
> @@ -680,3 +679,5 @@
>       new_point=.false.
>       return
>       end
> +
> +
> 
> === modified file 'Template/NLO/SubProcesses/splitorders_stuff.f'
> --- Template/NLO/SubProcesses/splitorders_stuff.f	2020-06-26 09:32:02 +0000
> +++ Template/NLO/SubProcesses/splitorders_stuff.f	2021-03-24 10:12:56 +0000
> @@ -65,6 +65,22 @@
> 
>       return 
>       end
> +
> +
> +      integer function get_orders_tag_from_amp_pos(iamp)
> +C     calls get_orders_tag for the orders corresponding to 
> +C     the iamp-th amp_split
> +      implicit none
> +      integer iamp
> +      include 'orders.inc'
> +      integer ord(nsplitorders)
> +      integer get_orders_tag
> +
> +      call amp_split_pos_to_orders(iamp, ord)
> +      get_orders_tag_from_amp_pos = get_orders_tag(ord)
> +
> +      return
> +      end
> 
> 
>       integer function orders_to_amp_split_pos(ord)
> @@ -149,6 +165,7 @@
>       subroutine check_amp_split()
> C check that amp_split_pos_to_orders and orders_to_amp_split_pos behave
> C as expected (one the inverse of the other)
> +C Check also get_orders_tag vs get_orders_tag_from_amp_pos
> C Stop the code if anything wrong is found
> C Also, print on screen a summary of the orders in amp_split 
>       implicit none
> @@ -156,19 +173,30 @@
>       integer orders_to_amp_split_pos
>       integer i, pos
>       integer ord(nsplitorders)
> +      integer get_orders_tag, get_orders_tag_from_amp_pos
> 
>       do i = 1, amp_split_size
>         call amp_split_pos_to_orders(i, ord)
>         pos = orders_to_amp_split_pos(ord)
> +
>         if (pos.ne.i) then
> -          write(*,*) 'ERROR in check amp_split', pos, i 
> +          write(*,*) 'ERROR#1 in check amp_split', pos, i 
>           write(*,*) 'ORD is ', ord
>           stop 1
>         endif
> +
> +        if (get_orders_tag(ord).ne.get_orders_tag_from_amp_pos(i)) then
> +          write(*,*) 'ERROR#2 in check amp_split', get_orders_tag(ord), 
> +     $    get_orders_tag_from_amp_pos(i) 
> +          write(*,*) 'I, ORD ', i, ord
> +          stop 1
> +        endif
> +
>         write(*,*) 'AMP_SPLIT: ', i, 'correspond to S.O.', ord
>       enddo
> 
>       return
>       end
> 
> -      
> +
> +
> 
> === modified file 'Template/NLO/SubProcesses/test_soft_col_limits.f'
> --- Template/NLO/SubProcesses/test_soft_col_limits.f	2018-12-21 15:27:32 +0000
> +++ Template/NLO/SubProcesses/test_soft_col_limits.f	2021-03-24 10:12:56 +0000
> @@ -18,12 +18,12 @@
>       double precision max_fail
>       parameter       (max_fail=0.3d0)
>       integer i,j,k,n,l,jj,bs_min,bs_max,iconfig_in,nsofttests
> -     $     ,ncolltests,nerr,imax,iflag,iret,ntry,fks_conf_number
> +     $     ,ncolltests,imax,iflag,iret,ntry,fks_conf_number
>      $     ,fks_loop_min,fks_loop_max,fks_loop,ilim
>       double precision fxl(15),wfxl(15),limit(15),wlimit(15),lxp(0:3
>      $     ,nexternal+1),xp(15,0:3,nexternal+1),p(0:3,nexternal),wgt
>      $     ,x(99),fx,totmass,xi_i_fks_fix_save,y_ij_fks_fix_save
> -     $     ,fail_frac,pmass(nexternal)
> +     $     ,pmass(nexternal)
>       double complex wgt1(2)
>       integer fks_j_from_i(nexternal,0:nexternal)
>      &     ,particle_type(nexternal),pdg_type(nexternal)
> @@ -72,6 +72,8 @@
>       include 'orders.inc'
>       integer iamp
>       integer orders(nsplitorders)
> +      integer nerr(0:amp_split_size)
> +      double precision fail_frac(0:amp_split_size)
>       double precision fxl_split(15,amp_split_size),wfxl_split(15
>      $     ,amp_split_size)
>       double precision limit_split(15,amp_split_size), wlimit_split(15
> @@ -252,7 +254,7 @@
>          Hevents=.true.
>          softtest=.true.
>          colltest=.false.
> -         nerr=0
> +         nerr(:)=0
>          imax=10
>          do j=1,nsofttests
>             do iamp=1,amp_split_size
> @@ -417,6 +419,7 @@
>                         call xprintout(6,limit_split(i,iamp),fxl_split(i
>      $                       ,iamp))
>                      enddo
> +                     iflag=0
>                      call checkres2(limit_split(1,iamp),fxl_split(1
>      $                    ,iamp),wlimit_split(1,iamp),wfxl_split(1,iamp)
>      $                    ,xp,lxp,iflag,imax,j,i_fks,j_fks
> @@ -442,7 +445,7 @@
>                iflag=0
>                call checkres2(limit,fxl,wlimit,wfxl,xp,lxp,
>      &              iflag,imax,j,i_fks,j_fks,iret)
> -               nerr=nerr+iret
> +               nerr(0)=nerr(0)+iret
>            ! check the contributions coming from each splitorders
>            ! only look at the non vanishing ones
>                do iamp=1, amp_split_size
> @@ -452,7 +455,7 @@
>      $                    ,iamp),wlimit_split(1,iamp),wfxl_split(1,iamp)
>      $                    ,xp,lxp,iflag,imax,j,i_fks,j_fks
>      $                    ,iret)
> -                     nerr=nerr+iret
> +                     nerr(iamp)=nerr(iamp)+iret
>                   endif
>                enddo
>             endif
> @@ -460,12 +463,24 @@
>          if(nsofttests.gt.10)then
>             write(*,*)'Soft tests done for (Born) config',iconfig
>             write(*,*)'Failures:',nerr
> -            fail_frac= nerr/dble(nsofttests)
> -            if (fail_frac.lt.max_fail) then
> -               write(*,401) nFKSprocess, fail_frac
> -            else
> -               write(*,402) nFKSprocess, fail_frac
> -            endif
> +            do iamp = 0, amp_split_size
> +                if (iamp.gt.0.and.iamp.le.amp_split_size_born) cycle
> +                fail_frac(iamp)= nerr(iamp)/dble(nsofttests)
> +                if (iamp.ne.0) then
> +                   write(*,fmt="(a,i3,a)",advance="no")'Split-order',iamp,': '
> +                   call amp_split_pos_to_orders(iamp,orders)
> +                   do i = 1, nsplitorders
> +                      write(*,fmt="(a,a,i3,a)",advance="no") ordernames(i), ':',orders(i),'; '
> +                   enddo
> +                else
> +                   write(*,fmt="(a)", advance="no")'Sum of all orders: '
> +                endif
> +                if (fail_frac(iamp).lt.max_fail) then
> +                   write(*,401) nFKSprocess, fail_frac(iamp)
> +                else
> +                   write(*,402) nFKSprocess, fail_frac(iamp)
> +                endif
> +            enddo
>          endif
> 
>          write (*,*) ''
> @@ -480,7 +495,7 @@
>          softtest=.false.
>          colltest=.true.
> 
> -         nerr=0
> +         nerr(:)=0
>          imax=10
>          do j=1,ncolltests
>             do iamp=1,amp_split_size
> @@ -625,6 +640,7 @@
>                         call xprintout(6,limit_split(i,iamp),fxl_split(i
>      $                       ,iamp))
>                      enddo
> +                     iflag=1
>                      call checkres2(limit_split(1,iamp),fxl_split(1
>      $                    ,iamp),wlimit_split(1,iamp),wfxl_split(1,iamp)
>      $                    ,xp,lxp,iflag,imax,j,i_fks,j_fks
> @@ -650,7 +666,7 @@
>                iflag=1
>                call checkres2(limit,fxl,wlimit,wfxl,xp,lxp,
>      &              iflag,imax,j,i_fks,j_fks,iret)
> -               nerr=nerr+iret
> +               nerr(0)=nerr(0)+iret
>            ! check the contributions coming from each splitorders
>            ! only look at the non vanishing ones
>                do iamp=1, amp_split_size
> @@ -659,7 +675,7 @@
>                      call checkres2(limit_split(1,iamp),fxl_split(1,iamp),
>      &                    wlimit_split(1,iamp),wfxl_split(1,iamp),xp,lxp,
>      &                    iflag,imax,j,i_fks,j_fks,iret)
> -                     nerr=nerr+iret
> +                     nerr(iamp)=nerr(iamp)+iret
>                   endif
>                enddo
>             endif
> @@ -667,12 +683,24 @@
>          if(ncolltests.gt.10)then
>             write(*,*)'Collinear tests done for (Born) config', iconfig
>             write(*,*)'Failures:',nerr
> -            fail_frac= nerr/dble(ncolltests)
> -            if (fail_frac.lt.max_fail) then
> -               write(*,501) nFKSprocess, fail_frac
> -            else
> -               write(*,502) nFKSprocess, fail_frac
> -            endif
> +            do iamp = 0, amp_split_size
> +                if (iamp.gt.0.and.iamp.le.amp_split_size_born) cycle
> +                fail_frac(iamp)= nerr(iamp)/dble(nsofttests)
> +                if (iamp.ne.0) then
> +                   write(*,fmt="(a,i3,a)",advance="no")'Split-order',iamp,': '
> +                   call amp_split_pos_to_orders(iamp,orders)
> +                   do i = 1, nsplitorders
> +                      write(*,fmt="(a,a,i3,a)",advance="no") ordernames(i), ':',orders(i),'; '
> +                   enddo
> +                else
> +                   write(*,fmt="(a)", advance="no")'Sum of all orders: '
> +                endif
> +                if (fail_frac(iamp).lt.max_fail) then
> +                   write(*,501) nFKSprocess, fail_frac(iamp)
> +                else
> +                   write(*,502) nFKSprocess, fail_frac(iamp)
> +                endif
> +            enddo
>          endif
> 
>  123     continue
> 
> === modified file 'Template/NLO/SubProcesses/weight_lines.f'
> --- Template/NLO/SubProcesses/weight_lines.f	2018-02-08 13:56:27 +0000
> +++ Template/NLO/SubProcesses/weight_lines.f	2021-03-24 10:12:56 +0000
> @@ -8,7 +8,7 @@
>          integer, allocatable :: itype(:),nFKS(:),QCDpower(:),pdg(:,:)
>      $        ,pdg_uborn(:,:),parton_pdg_uborn(:,:,:),parton_pdg(:,:,:)
>      $        ,plot_id(:),niproc(:),ipr(:),parton_pdf(:,:,:)
> -     $        ,icontr_sum(:,:),orderstag(:)
> +     $        ,icontr_sum(:,:),orderstag(:),amppos(:)
>          double precision, allocatable :: momenta(:,:,:),momenta_m(:,:,:
>      $        ,:),wgt(:,:),wgt_ME_tree(:,:),bjx(:,:),scales2(:,:)
>      $        ,g_strong(:),wgts(:,:),parton_iproc(:,:),y_bst(:)
> @@ -119,6 +119,10 @@
>          allocate(itemp1(n_contr))
>          itemp1(1:max_contr)=orderstag
>          call move_alloc(itemp1,orderstag)
> +c amppos
> +         allocate(itemp1(n_contr))
> +         itemp1(1:max_contr)=amppos
> +         call move_alloc(itemp1,amppos)
> c parton_pdf
>          allocate(itemp3(nexternal,max_iproc,n_contr))
>          itemp3(1:nexternal,1:max_iproc,1:max_contr)=parton_pdf
> @@ -209,6 +213,7 @@
>       allocate(niproc(1))
>       allocate(ipr(1))
>       allocate(orderstag(1))
> +      allocate(amppos(1))
>       allocate(parton_pdf(nexternal,1,1))
>       allocate(icontr_sum(0:1,1))
>       allocate(momenta(0:3,nexternal,1))
> @@ -250,6 +255,7 @@
>       if (allocated(niproc)) deallocate(niproc)
>       if (allocated(ipr)) deallocate(ipr)
>       if (allocated(orderstag)) deallocate(orderstag)
> +      if (allocated(amppos)) deallocate(amppos)
>       if (allocated(parton_pdf)) deallocate(parton_pdf)
>       if (allocated(icontr_sum)) deallocate(icontr_sum)
>       if (allocated(momenta)) deallocate(momenta)
> 
> === modified file 'Template/NLO/Utilities/NLO_Born3.py'
> --- Template/NLO/Utilities/NLO_Born3.py	2013-03-08 11:06:57 +0000
> +++ Template/NLO/Utilities/NLO_Born3.py	2021-03-24 10:12:56 +0000
> @@ -1,5 +1,8 @@
> #! /usr/bin/env python
> 
> +from __future__ import print_function
> +from __future__ import absolute_import
> +from six.moves import range
> inp = open('./MADatNLO.top', 'r')
> out = open('./MADatNLO_combined.top', 'w')
> 
> @@ -28,10 +31,10 @@
> 
> stopNLO.insert(0,0)
> 
> -print startNLO
> -print stopNLO
> -print startBorn
> -print stopBorn
> +print(startNLO)
> +print(stopNLO)
> +print(startBorn)
> +print(stopBorn)
> 
> 
> for j in range(len(startNLO)):
> 
> === modified file 'Template/NLO/Utilities/VetoPrefactors/resum_reweighter.py'
> --- Template/NLO/Utilities/VetoPrefactors/resum_reweighter.py	2016-04-15 11:14:25 +0000
> +++ Template/NLO/Utilities/VetoPrefactors/resum_reweighter.py	2021-03-24 10:12:56 +0000
> @@ -9,6 +9,7 @@
> #
> ################################################################################
> 
> +from __future__ import absolute_import
> import os
> import re
> import subprocess
> @@ -107,7 +108,7 @@
> 
> # Detect the total number of event in an efficient way
> n_evts = int(subprocess.Popen('grep -rin "<event>" %s | wc -l'%os.path.realpath(eventFile),
> -                        stdout=subprocess.PIPE, shell=True).communicate()[0])
> +                              stdout=subprocess.PIPE, shell=True).communicate()[0].decode())
> 
> logging.info("Writing out the reweighted event file on\n   %s"%outPath)
> # Write out the output event file
> 
> === modified file 'Template/NLO/Utilities/VetoPrefactors/virt_reweighter.py'
> --- Template/NLO/Utilities/VetoPrefactors/virt_reweighter.py	2016-09-22 10:05:43 +0000
> +++ Template/NLO/Utilities/VetoPrefactors/virt_reweighter.py	2021-03-24 10:12:56 +0000
> @@ -9,6 +9,7 @@
> #
> ################################################################################
> 
> +from __future__ import absolute_import
> import os
> import re
> import subprocess
> @@ -174,7 +175,7 @@
> 
> # Detect the total number of event in an efficient way
> n_evts = int(subprocess.Popen('grep -rin "<event>" %s | wc -l'%os.path.realpath(eventFile),
> -                        stdout=subprocess.PIPE, shell=True).communicate()[0])
> +                              stdout=subprocess.PIPE, shell=True).communicate()[0].decode())
> 
> logging.info("Writing out the reweighted event file on\n   %s"%outPath)
> # Write out the output event file
> 
> === modified file 'Template/NLO/Utilities/collect_plots.py'
> --- Template/NLO/Utilities/collect_plots.py	2020-07-04 19:02:47 +0000
> +++ Template/NLO/Utilities/collect_plots.py	2021-03-24 10:12:56 +0000
> @@ -1,3 +1,5 @@
> +from __future__ import absolute_import
> +from __future__ import print_function
> import pickle
> import subprocess
> import sys
> @@ -25,7 +27,7 @@
>     while p.poll() is None:
>         line = p.stdout.readline()
>         if any(t in line for t in ['INFO:','WARNING:','CRITICAL:','ERROR:','KEEP:']):
> -            print line[:-1]
> +            print(line[:-1])
> 
> with open("SubProcesses/job_status.pkl",'rb') as f:
>     jobs_to_collect=pickle.load(f)
> 
> === modified file 'Template/NLO/Utilities/makefile'
> --- Template/NLO/Utilities/makefile	2018-02-05 08:18:56 +0000
> +++ Template/NLO/Utilities/makefile	2021-03-24 10:12:56 +0000
> @@ -5,7 +5,7 @@
> EXTRAW=-I../Source
> FF=gfortran -g -fno-automatic -ffixed-line-length-132 $(INCLUDE) $(EXTRAW) 
> FILES=handling_lhe_events.o fill_MC_mshell.o extra_weights.o
> -FILES2=madfks_plot.o setcuts.o open_output_files.o appl_interface_dummy.o
> +FILES2=madfks_plot.o setcuts.o open_output_files.o pineappl_interface_dummy.o
> TDFILES=dbook.o open_output_files_dummy_td.o 
> HWUFILES=HwU.o open_output_files_dummy_HwU.o 
> 
> @@ -15,7 +15,7 @@
> all: check_events combine_plots compare_events merge_events plot_events \
> 	plot_events_lhef select_events split_events sum_plots uncertainties
> 
> -check_events : $(FILES) check_events.o dbook.o appl_interface_dummy.o
> +check_events : $(FILES) check_events.o dbook.o pineappl_interface_dummy.o
> 	$(FF) $^ -o $@
> 
> combine_plots : combine_plots.o
> @@ -52,4 +52,4 @@
> 	@rm -f *.o
> 	@rm -f check_events combine_plots compare_events merge_events plot_events \
> 	plot_events_lhef select_events split_events sum_plots uncertainties
> -	@rm -f LHEF.* res_wgt headfile
> \ No newline at end of file
> +	@rm -f LHEF.* res_wgt headfile
> 
> === modified file 'Template/NLO/bin/aMCatNLO'
> --- Template/NLO/bin/aMCatNLO	2016-02-23 11:25:14 +0000
> +++ Template/NLO/bin/aMCatNLO	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> 
> ################################################################################
> #
> @@ -19,10 +19,17 @@
> and call immediately the command line interface scripts"""
> 
> import sys
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadGraph/aMCatNLO 5 works only with python 2.6 or later (but not python 3.X).\n\
> +if   sys.version_info[1] < 7:
> +    sys.exit('MadGraph/aMCatNLO 5 works only with python 2.7/3.7 or later .\n\
>                Please upgrate your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> +    
> import os
> import optparse
> 
> @@ -59,7 +66,7 @@
>     try:
>         (options, args) = parser.parse_args(sys.argv[1:len(sys.argv)-i])
>         done = True
> -    except MyOptParser.InvalidOption, error:
> +    except MyOptParser.InvalidOption as error:
>         pass 
>     else:
>         args += sys.argv[len(sys.argv)-i:]
> @@ -67,8 +74,8 @@
>     # raise correct error:
>     try:
>         (options, args) = parser.parse_args()
> -    except MyOptParser.InvalidOption, error:
> -        print error
> +    except MyOptParser.InvalidOption as error:
> +        print(error)
>         sys.exit(2)  
> 
> if len(args) == 0:
> @@ -79,7 +86,7 @@
> # Check if optimize mode is (and should be) activated
> if __debug__ and not options.debug and \
>     (not os.path.exists(os.path.join(root_path,'../..', 'bin','create_release.py')) or options.web):
> -        print 'launch in debug mode'
> +        print( 'launch in debug mode')
>         subprocess.call([sys.executable] + ['-O'] + sys.argv)
>         sys.exit()
> 
> @@ -92,7 +99,7 @@
>     try:
>         import pyreadline as readline
>     except:
> -        print "For tab completion and history, install module readline."
> +        print( "For tab completion and history, install module readline.")
> else:
>     import rlcompleter
> 
> @@ -123,7 +130,7 @@
>    pass
> 
> if __debug__:
> -        print 'Running MG5 in debug mode'
> +        print( 'Running MG5 in debug mode')
> 
> 
> # Set logging level according to the logging level given by options
> @@ -170,10 +177,10 @@
>             cmd_line = cmd_interface.aMCatNLOCmdShell()
>         if not hasattr(cmd_line, 'do_%s' % args[0]):
>             if parser_error:
> -                print parser_error
> -                print 'and %s  can not be interpreted as a valid command.' % args[0]
> +                print( parser_error)
> +                print( 'and %s  can not be interpreted as a valid command.' % args[0])
>             else:
> -                print 'ERROR: %s  not a valid command. Please retry' % args[0]
> +                print( 'ERROR: %s  not a valid command. Please retry' % args[0])
>         else:
>             cmd_line.use_rawinput = False    
>             cmd_line.run_cmd(' '.join(args))
> @@ -188,9 +195,9 @@
>             cmd_line.cmdloop()
> 
> except KeyboardInterrupt:
> -    print 'writting history and directory and quit on KeyboardInterrupt' 
> +    print( 'writting history and directory and quit on KeyboardInterrupt')
>     pass
> -except cmd_interface.aMCatNLOAlreadyRunning, error:
> +except cmd_interface.aMCatNLOAlreadyRunning as error:
>     logging.error(str(error))
>     sys.exit()
> try: 
> @@ -205,7 +212,7 @@
>     if cmd_line.history[-1] not in ['EOF','quit','exit']:
>         cmd_line.results.store_result()
> except:
> -    print error
> +    print( error)
>     pass
> 
> 
> 
> === modified file 'Template/NLO/bin/calculate_xsect'
> --- Template/NLO/bin/calculate_xsect	2013-11-13 02:21:10 +0000
> +++ Template/NLO/bin/calculate_xsect	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> ################################################################################
> #
> # Copyright (c) 2011 The MadGraph5_aMC@NLO Development team and Contributors
> @@ -28,11 +28,18 @@
> sys.path.append(pjoin(root_path,'bin','internal'))
> import amcatnlo_run_interface as run      
> 
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadEvent works with python 2.6 or higher (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadEvent works with python 2.7/3.7 or higher.\n\
>                Please upgrade your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> 
> +    
> def set_configuration():
>     import coloring_logging
>     logging.config.fileConfig(os.path.join(root_path, 'bin', 'internal', 'me5_logging.conf'))
> @@ -47,25 +54,25 @@
>     try:
>         mode = int(argument[1])
>     except:
> -        mode = int(raw_input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
> +        mode = int(six.moves.input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
>     if mode == 0:
>         try:
>             name = argument[2]
>         except:
> -            name = raw_input('Enter run name\n')
> +            name = six.moves.input('Enter run name\n')
>     else:
>         try:
>             opt = argument[2]
>         except:
>             if mode == 1: 
> -                opt = raw_input('Enter name for jobs on pbs queue\n')
> +                opt = six.moves.input('Enter name for jobs on pbs queue\n')
>             else:
> -                opt = int(raw_input('Enter number of cores\n'))
> +                opt = int(six.moves.input('Enter number of cores\n'))
> 
>         try:
>             name = argument[3]
>         except:
> -            name = raw_input('enter run name\n')
> +            name = six.moves.input('enter run name\n')
> 
> #    launch = ME.MadEventCmd(me_dir=root_path)
> 
> 
> === modified file 'Template/NLO/bin/generate_events'
> --- Template/NLO/bin/generate_events	2014-01-10 14:03:59 +0000
> +++ Template/NLO/bin/generate_events	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> ################################################################################
> #
> # Copyright (c) 2011 The MadGraph5_aMC@NLO Development team and Contributors
> @@ -28,11 +28,18 @@
> sys.path.append(pjoin(root_path,'bin','internal'))
> import amcatnlo_run_interface as run      
> 
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadEvent works with python 2.6 or higher (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadEvent works with python 2.7/3.7 or higher.\n\
>                Please upgrade your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> 
> +    
> def set_configuration():
>     import coloring_logging
>     logging.config.fileConfig(os.path.join(root_path, 'bin', 'internal', 'me5_logging.conf'))
> @@ -47,25 +54,25 @@
>     try:
>         mode = int(argument[1])
>     except:
> -        mode = int(raw_input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
> +        mode = int(six.moves.input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
>     if mode == 0:
>         try:
>             name = argument[2]
>         except:
> -            name = raw_input('Enter run name\n')
> +            name = six.moves.input('Enter run name\n')
>     else:
>         try:
>             opt = argument[2]
>         except:
>             if mode == 1: 
> -                opt = raw_input('Enter name for jobs on pbs queue\n')
> +                opt = six.moves.input('Enter name for jobs on pbs queue\n')
>             else:
> -                opt = int(raw_input('Enter number of cores\n'))
> +                opt = int(six.moves.input('Enter number of cores\n'))
> 
>         try:
>             name = argument[3]
>         except:
> -            name = raw_input('enter run name\n')
> +            name = six.moves.input('enter run name\n')
> 
> #    launch = ME.MadEventCmd(me_dir=root_path)
> 
> 
> === modified file 'Template/NLO/bin/internal/split_jobs.py'
> --- Template/NLO/bin/internal/split_jobs.py	2014-06-17 10:43:25 +0000
> +++ Template/NLO/bin/internal/split_jobs.py	2021-03-24 10:12:56 +0000
> @@ -1,8 +1,12 @@
> #!/usr/bin/env python
> #  MZ, 2012-06-14
> +from __future__ import absolute_import
> +from __future__ import print_function
> import os
> import sys
> import tarfile
> +from six.moves import range
> +from six.moves import input
> 
> class SplitJobsError(Exception):
>     pass
> @@ -32,16 +36,16 @@
>                     %(dir, chann, ev_type))
> 
> 
> -print 'nevents_unweighted read, found %d jobs with a total of %d events' % (len(jobs), tot_events)
> +print('nevents_unweighted read, found %d jobs with a total of %d events' % (len(jobs), tot_events))
> 
> max_dict = {}
> 
> for (k, max_n) in max_events.items():
>     if max_n:
> -        print 'Max %s-events per channel found is %d' % (k, max_n)
> +        print('Max %s-events per channel found is %d' % (k, max_n))
>         max_dict[k] = max(max_n/20, 100)
>         if max_dict[k]:
> -            print 'Max number of events in splitted job is %d' % max_dict[k]
> +            print('Max number of events in splitted job is %d' % max_dict[k])
> 
> 
> if len(sys.argv) == 2:
> @@ -59,21 +63,21 @@
>     ntot_dict = {}
>     for k in max_dict.keys():
>         ntot_dict[k] = sum(d['nsplit'] for d in jobs if d['type'] == k) 
> -    print 'This will give:'
> +    print('This will give:')
>     for k, tot in ntot_dict.items():
>         if tot:
> -            print '  %d %s-events jobs' % (tot, k)
> +            print('  %d %s-events jobs' % (tot, k))
>     if len(sys.argv) == 2:
>         break
> -    yes = input('Is this acceptable? (1: yes 0: no) ')
> +    yes = eval(input('Is this acceptable? (1: yes 0: no) '))
>     if yes == 1:
>         break
> 
>     for (k, max_n) in max_events.items():
>         if max_n:
> -            print 'Found %s-events' % k 
> -            print 'Max %s-events per channel found is %d' % (k, max_n)
> -            new_max = input('Give new maximum if you want to split jobs ') 
> +            print('Found %s-events' % k) 
> +            print('Max %s-events per channel found is %d' % (k, max_n))
> +            new_max = eval(input('Give new maximum if you want to split jobs ')) 
>             max_dict[k] = new_max
> 
> 
> @@ -121,7 +125,7 @@
>                     arcname=os.path.split(nevts_filename)[1])
>             os.remove(nevts_filename)
> 
> -    print '%s, %s, Original %d, after splitting %d' % (job['dir'], job['channel'], job['nevts'], job_events)
> +    print('%s, %s, Original %d, after splitting %d' % (job['dir'], job['channel'], job['nevts'], job_events))
> 
> 
> new_nevents_file = open('nevents_unweighted_splitted', 'w')
> @@ -131,7 +135,7 @@
> for dir in dirs:
>     tar_dict[dir].close()
> 
> -print 'Done, total %d events' %  tot_events
> +print('Done, total %d events' %  tot_events)
> 
> 
> 
> 
> === removed file 'Template/NLO/bin/newprocess_mg5'
> === modified file 'Template/NLO/bin/shower'
> --- Template/NLO/bin/shower	2013-11-13 02:21:10 +0000
> +++ Template/NLO/bin/shower	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,4 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> ################################################################################
> #
> # Copyright (c) 2011 The MadGraph5_aMC@NLO Development team and Contributors
> @@ -28,10 +28,16 @@
> sys.path.append(pjoin(root_path,'bin','internal'))
> import amcatnlo_run_interface as run      
> 
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadEvent works with python 2.6 or higher (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadEvent works with python 2.7 or 3.7 and higher.\n\
>                Please upgrade your version of python.')
> 
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip install six --user"\n'
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> 
> def set_configuration():
>     import coloring_logging
> @@ -47,25 +53,25 @@
>     try:
>         mode = int(argument[1])
>     except:
> -        mode = int(raw_input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
> +        mode = int(six.moves.input('Enter 2 for multi-core, 1 for parallel, 0 for serial run\n'))
>     if mode == 0:
>         try:
>             name = argument[2]
>         except:
> -            name = raw_input('Enter run name\n')
> +            name = six.moves.input('Enter run name\n')
>     else:
>         try:
>             opt = argument[2]
>         except:
>             if mode == 1: 
> -                opt = raw_input('Enter name for jobs on pbs queue\n')
> +                opt = six.moves.input('Enter name for jobs on pbs queue\n')
>             else:
> -                opt = int(raw_input('Enter number of cores\n'))
> +                opt = int(six.moves.input('Enter number of cores\n'))
> 
>         try:
>             name = argument[3]
>         except:
> -            name = raw_input('enter run name\n')
> +            name = six.moves.input('enter run name\n')
> 
> #    launch = ME.MadEventCmd(me_dir=root_path)
> 
> 
> === modified file 'UpdateNotes.txt'
> --- UpdateNotes.txt	2020-07-06 19:41:16 +0000
> +++ UpdateNotes.txt	2021-03-24 10:12:56 +0000
> @@ -1,5 +1,28 @@
> Update notes for MadGraph5_aMC@NLO (in reverse time order)
> 
> +                        ** PARRALEL VERSION FOR EW branch **
> +
> +3.0.4 (21/08/20)
> +    ALL: include all changes up to 2.9.3 of the 2.x release
> +    ALL: pass to python3 by default
> +    MZ+RF+OM: Fix relevant to the case when PDG specific cuts are set in the NLO run_card.
> +        The generation of tau was not taking into account the information.
> +    MZ+RF+OM: Fix relevant to the case when PDG specific cuts are set in the NLO run_card.
> +        The generation of tau was not taking into account the information.
> +    MZ+SC+ERN+CS: The code can be linked to PineAPPL (arXiv:2008.12789), making it possible
> +	 to generate PDF-independent fast-interploation grids including EW corrections.
> +	 This supersedes the interface to ApplGrid+aMCFast which was not working in v3
> +    MZ: Change syntax meaning in 3.0 series to be consistent with the one of 2.0 series:
> +        QCD<=X, QED<=Y apply at the amplitude level (not to the squared amplitude anymore).
> +        Squared-amplitude constraints can be imposed by using the usual squared-order 
> +        syntax, e.g.:
> +	QCD^2<=X, QED^2<=Y (constrained at the diagram squared level).
> +    MZ: Different coupling combinations and their scale variations are written in the
> +        event file as extra weights
> +    OM: Some aliases have been added for the orders constraints:
> +            - aEW<=X / aS<=Y is equivalent to QCD^2<=2X / QED^2<=2Y
> +            - EW<=X / EW^2<=X is equivalent to QED<=X / QED^2<=X
> +
> 3.0.3 (06/07/20)
>      include up to 2.7.3
> 
> @@ -36,6 +59,169 @@
>      RF: Reduction of the number of jobs -- results in earlier detection of small integration channels for fNLO
>      OM: remove ./bin/mg5 executable
> 
> +                             ** Main Branch (version 2.x) Update **
> +2.9.3()
> +      OM: Fix an issue with t-channel particles for massive initial state where sqrt(S)
> +          was close to the mass of the initial mass. boundary condition on t-channnel were
> +	  incorrectly setup leading to strange spectrum in various distribution (very old bug)
> +      OM: Fix an issue with a crash for loop computation
> +      OM: more python3 fixing bug
> +	  
> +
> +2.9.2(14/02/21)
> +      MZ+RF+OM: Fix relevant to the case when PDG specific cuts are set in the NLO run_card.
> +        The generation of tau was not taking into account the information.
> +      OM: fix an issue when running with python3 where the normalization of pythia8 file were wrong
> +          when pythia8 was run in parralel.
> +      OM: fixing more issue  related to MSSM (introduced within 2.9.0)
> +      OM: fixing issue with loop-induced processus (introduced within 2.9.0)
> +      OM: Fix some wrong scale variation at NLO+PS (introduced in 2.9.0)
> +      OM: Fix an issue with the installation of pythia-pgs
> +      
> +
> +2.9.1.2 (02/02/21)
> +      Kiran+OM: Fixing issue for the MSSM model
> +      OM: Fixing issue with mac support
> +      OM: fix a bug introduced within 2.8.2 related to a wrong phase-space mapping of conflicting resonances.
> +          Leading to zero cross-section and/or potential bias cross-section for more complex cases.
> +	  The issue occurs only if you have a conflicting resonances followed by a massless propopagator.
> +	  one example is generate p p > z h , z > e+ e-, h > b b~ a
> +
> +2.9.0 (30/01/21)    **** Major speed-up update for LO computation ***
> +      Kiran+OM: Optimization of the matrix-element at run-time using recycling helicity method
> +                - This fasten LO computation by a factor around 2
> +		- This can be turned off via the command "output PATH --hel_recycling=False"
> +      OM: Various optimization fot T-channel integration
> +          - use different ordering for T-channel. Four different ordering have been implemented
> +	    at generation time, the code decides which ordering to use channel-per-channel.
> +	    This can be turned off via the command "output PATH --t_strategy=2"
> +	  - increase number of maximum iteration for double or more T-channel
> +	  - implement an alternative to the standard multi-channel.
> +	     instead of using the amplitude square it use the product of the denominator
> +	     (the default strategy use depends of the process)
> +	  - speed-up for VBF type of process  are often around 100 times faster
> +	  - This fixes a lot of issue for processes failing to generate the targetted number of events.
> +      OM: Better version of the color-computation (but this leads to only modest gain but for very complex processes.)
> +          This optimizations leads to a longer generation time of the code (only for complex processes).
> +	  This can be turned off  via "output PATH --jamp_optim=False"
> +      OM: New parameter in the run_card:
> +          - sde_strategy: allows to change the default multi-channel strategy
> +	  - a new phase-space optimization parameter are now easily availabe via the command "update ps_optim" 
> +      OM: New global parameter "auto_convert_model"
> +          if set on True (set auto_convert_model T or via input/mg5_configuration.txt)
> +	  all model crashing due to a python3 compatibility issue of the UFO model will be automatically converted
> +	  to a python3 compatible model. 
> +
> +2.8.3 (26/01/21):
> +      OM: Buch of bunch fixing related to python3 issue (mainly related to unicode encoding)
> +      OM: Various fix for reweighting with loop (mainly with python3 as well)
> +      OM: Fix a potential bug for polarized sample with at least three polarised particles with a least two
> +          identical particles and one different polarised particle.
> +      OM: Fix various bug for maddm interface (thanks Daniele)
> +      OM: Fix various issue with overall order usage
> +      OM: Fix compatibility with MacOS 11
> +      OM: fix additional GCC10 compatibility issue
> +      OM: fix issue for 1>n process where width were set to zero automatically (introduced in 2.8.0)
> +      OM: fix aloha output mode for python output
> +      OM: avoid a bug with helicity filtering that was kept for all benchmark when using
> +          multiple successive re-weighting
> +      OM: Edition of the reweighting card via "set" command is not starting from the original param_card
> +          used to generated the events file and not from the model default anymore.
> +      OM: Interference have now their default dynamical scale set to HT/2
> +
> +
> +2.8.2 (30/10/20):
> +      OM: Fix a bug when setting width to zero where they were actually set to 1e-6 times the width
> +          This can lead to bias in the cross-section if your process is very sensitive to the cross-section
> +	  due to gauge cancelation. Bug introduced in version 2.6.4.
> +      OM: Hide Block parameter loop from NLO model but for madloop run.
> +          The factorization scale is still determine by the setup of the run_card as before
> +      OM: Fix couple of python3 specific bug
> +
> +2.8.1(24/09/20):
> +      OM: Change user interface related to FxFx mode
> +          - If you have multiple multiplicities at NLO,
> +	    - the default run_card is modified accordingly
> +	        - has icckw=3 and follow the official FxFx recomendation (i.e. for
> +		  scale and jet algo)
> +            - the shower card has two parameter that are dynamically set 
> +                - njmax (default: -1) is automatically set depending of the process definition
> +                - Qcut (default: -1) is now automatically set to twice ptj parameter
> +            - the default parton-shower is automatically set to Pythia8
> +          - The value of the cross-section after FxFx formalism (removing double counting) is
> +	    now printed on the log and available on the HTML page
> +      OM: Fix for the auto width for three body decay in presence of identical particles.
> +      OM: add support for __header__ in UFO model
> +      OM: allow restriction card to have auto-width
> +      OM: fixing some html link (removed ajax link forbidden by major web browser)
> +      OM: Various fix related to the python3 support
> +          - including more efficient model conversion method
> +
> +2.8.0 (21/08/20):
> +      OM: pass to python3 by default
> +      OM: For LO process, you can now set lpp1 and lpp2 to "4" for process with initial photon in order to get the
> +          effective photon approximation. This mode behaves like the "3" one: The cut-off scale of the approximation
> +	  is taken from the fixed renormalization factorisation scale: "dsqrt_q2fact1/dsqrt_q2fact2"
> +      OM: The width ao T-channel propagator are now set to zero automatically.
> +          To return to the previous behaviour , you can use the options "set zerowidth_tchannel False"
> +	  (to set before the output command)
> +      OM: Change in madevent phase-space integrator for T-channel:
> +            - The integration of photon/Z/Higgs are now done together rather than separatly and follow importance
> +	       sampling of the photon channel
> +	    - A new option "set max_t_for_channel X" allows to veto some channel of integration with more than X
> +	       t-channel propagator. This options can speed-up significantly the computation in VBF process.
> +	       (We advise to set X to 2 in those cases)
> +	    - Fix a numerical issue occuring for low invariant mass in T-channel creating spurious configuration.   
> +      OM: In madspin_card you can now replace the line "launch"
> +          by "launch -n NAME", this will allow to specify the name of the
> +	  directory in EVENTS where that run is stored.
> +      OM: Change in the python interface of the standalone output. In top of the pdg of the particles,
> +          you can now use the process_id (the one specified with @X) to distinguish process with the same particle
> +	  content. This parameter can be set to -1 and the function then ignore that parameter.
> +      OM: Adding new option in reweighting to allow the user to use the process_id in presence of ambiguous
> +          initial/final state.
> +      OM: Update the makefile of standalone interface to python to be able to compile in multicore.
> +           (thanks Matthias Komm)
> +      OM: Update of the auto-width code to support UFO form-factors
> +      OM: Fixing numerical issue  with the boost in EPA mode.
> +     
> +
> +                        ** PARRALEL VERSION FOR PYTHON 3 **
> +
> +2.7.3.py3(28/06/20):
> +      ALL: Contains all feature of 2.7.3 (see below)
> +      OM: Fix a crash when running PY8 in matched/merged mode (bug not present in not .py3 version of the code)
> +      MZ: low_mem_multicore_nlo_generation is working again
> +          but not for LOonly mode and not in OLP mode
> +
> +2.7.2.py3(25/03/20):
> +      ALL: Contains all feature of 2.7.2 (see below)
> +
> +2.7.1.py3(09/03/20):
> +      ALL: Contains all feature of 2.7.1 (see below)
> +      OM: Fixed a lot of python3 compatibility issue raised by user
> +          Particular Thanks to Congqio Li (CMS), Richard Ruiz and Leif Gellersen
> +	  for their reports.
> +
> +2.7.0.py3 (27/02/20):
> +      ALL: Contains all feature of 2.7.0			
> +      OM: Support for python3.7 in top of python 2.7
> +          - python2.6  is not supported anymore
> +	  - this requires the module "six" [pip install six --user]
> +      OM: dropping function set low_mem_multicore_nlo
> +      OM: dropping support for syscalc (c++ version)
> +      OM: introduction of new setup variable
> +          - f2py_compiler_py2 and f2py_compiler_py3
> +	    which will be used to overwrite f2py_compiler when using the associate python version
> +          - lhapdf_py2 and lhapdf_py3
> +	    same for lhapdf
> +      OM: introduction of a new command "convert model FULLPATH"
> +          - try to convert a UFO model compatible to python2 only to a new model compatible both with
> +	    Python2 and Python3 (no guarantee)
> +
> +
> +                             ** Main Branch  Update **
> +
> 2.7.3(21/06/20)
>       OM: Fixing some bug for read-only LO gridpacks (wrong cross-section and shape when generating events).
>           Thanks to Congqiao Li for this
> @@ -54,7 +240,11 @@
> 	       that are matching a given regular expression
>       OM: For Mac only, when running in script mode, MG5aMC will now prevent the computer to go to idle sleep.
>           You can prevent this by running with the '-s' option. like ./bin/mg5_aMC -s PATH_TO_CMD
> ->>>>>>> MERGE-SOURCE
> +
> +
> +2.7.2(17/03/20)
> +      OM: Fix a Bug in pythia8 running on Ubuntu 18.04.4 machine
> +      OM: Speed up standalone_cpp code by changing compilation flag
> 
> 2.7.2(17/03/20)
>       OM: Fix a Bug in pythia8 running on Ubuntu 18.04.4 machine
> @@ -82,7 +272,7 @@
> 	  directory as the param_card.dat.
> 
> 
> -2.7.0(10/01/20)
> +2.7.0(20/01/20)
>       OM: Allow for a new syntax in presence of multi-jet/lepton process:
>          generate p p > 3j replaces p p > j j j 
>       OM: Allow syntax for (fully) polarized particles at LO: [1912.01725]
> 
> === modified file 'VERSION'
> --- VERSION	2020-07-06 19:41:16 +0000
> +++ VERSION	2021-03-24 10:12:56 +0000
> @@ -1,5 +1,5 @@
> -version = 3.0.3
> -date = 2020-06-07
> +version = 3.0.4.beta
> +date = 2021-01-30
> 
> 
> 
> 
> === modified file 'aloha/aloha_fct.py'
> --- aloha/aloha_fct.py	2015-10-01 16:00:08 +0000
> +++ aloha/aloha_fct.py	2021-03-24 10:12:56 +0000
> @@ -10,9 +10,12 @@
> #
> #
> ################################################################################
> +from __future__ import absolute_import
> +from __future__ import print_function
> from aloha.aloha_object import *
> import aloha.aloha_lib as aloha_lib
> import cmath
> +from six.moves import range
> 
> class WrongFermionFlow(Exception):
>     pass
> @@ -29,7 +32,7 @@
>     try:
>         expr = eval(expression)
>     except Exception as error:
> -        print error
> +        print(error)
>         return
>     expr = expr.simplify()
>     #expr is now a valid AddVariable object if they are a sum or
> @@ -40,7 +43,7 @@
>     for term in expr:
>         if term.vartype == 0: # Single object
>             if not term.spin_ind in [[1,2], [2,1]]:
> -                raise WrongFermionFlow, 'Fermion should be the first particles of any interactions'
> +                raise WrongFermionFlow('Fermion should be the first particles of any interactions')
>             if isinstance(term, (Gamma, Gamma5, Sigma)):
>                 if term.spin_ind == [2,1]:
>                     out[1] = 2
> @@ -56,37 +59,37 @@
>                 if not obj.spin_ind:
>                     continue
>                 ind1, ind2 = obj.spin_ind
> -                if ind1 not in link.keys():
> +                if ind1 not in list(link.keys()):
>                     link[ind1] = ind2
>                 else:
> -                    raise WrongFermionFlow, 'a spin indices should appear only once on the left indices of an object: %s' % expr
> -                if ind2 not in rlink.keys():
> +                    raise WrongFermionFlow('a spin indices should appear only once on the left indices of an object: %s' % expr)
> +                if ind2 not in list(rlink.keys()):
>                     rlink[ind2] = ind1
>                 else: 
> -                    raise WrongFermionFlow, 'a spin indices should appear only once on the left indices of an object: %s' % expr             
> +                    raise WrongFermionFlow('a spin indices should appear only once on the left indices of an object: %s' % expr)             
> 
>             for i in range(1, nb_fermion):
> -                if i in out.keys() or i in out.values():
> +                if i in list(out.keys()) or i in list(out.values()):
>                     continue
>                 old = []
>                 pos = i
>                 while 1:
>                     old.append(pos)
> -                    if pos in link.keys() and link[pos] not in old:
> +                    if pos in list(link.keys()) and link[pos] not in old:
>                         pos = link[pos]
> -                    elif pos in rlink.keys() and rlink[pos] not in old:
> +                    elif pos in list(rlink.keys()) and rlink[pos] not in old:
>                         pos = rlink[pos]
>                     else:
> -                        if pos in link.keys() and i in rlink.keys():
> +                        if pos in list(link.keys()) and i in list(rlink.keys()):
>                             out[i] = pos
>                             break
> -                        elif pos in rlink.keys() and i in link.keys():
> +                        elif pos in list(rlink.keys()) and i in list(link.keys()):
>                             out[pos] = i
>                             break
>                         else:
> -                            raise WrongFermionFlow,  'incoherent IO state: %s' % expr
> +                            raise WrongFermionFlow('incoherent IO state: %s' % expr)
>     if not len(out) == nb_fermion //2:
> -        raise WrongFermionFlow, 'Not coherent Incoming/outcoming fermion flow'
> +        raise WrongFermionFlow('Not coherent Incoming/outcoming fermion flow')
>     return out
> 
> 
> @@ -112,10 +115,10 @@
>     for term in expr:
>         if term.vartype == 0: # Single object
>             if not term.spin_ind in [[1,2], [2,1]]:
> -                raise WrongFermionFlow, 'Fermion should be the first particles of any interactions'
> +                raise WrongFermionFlow('Fermion should be the first particles of any interactions')
>             if isinstance(term, (Gamma, Gamma5, Sigma)):
>                 if not term.spin_ind == [2,1]:
> -                    raise WrongFermionFlow, 'Not coherent Incoming/outcoming fermion flow'
> +                    raise WrongFermionFlow('Not coherent Incoming/outcoming fermion flow')
> 
>         elif term.vartype == 2: # product of object
>             link, rlink = {}, {}
> @@ -127,12 +130,12 @@
>                 if isinstance(obj, (Gamma, Sigma)):
>                     if (ind1 in range(1, nb_fermion+1) and ind1 % 2 == 1) or \
>                        (ind2 in range(2, nb_fermion+1) and ind2 % 2 == 0 ):
> -                        raise WrongFermionFlow, 'Not coherent Incoming/outcoming fermion flow'
> -                if ind1 not in link.keys():
> +                        raise WrongFermionFlow('Not coherent Incoming/outcoming fermion flow')
> +                if ind1 not in list(link.keys()):
>                     link[ind1] = ind2
>                 else:
>                     rlink[ind1] = ind2
> -                if ind2 not in link.keys():
> +                if ind2 not in list(link.keys()):
>                     link[ind2] = ind1
>                 else: 
>                     rlink[ind2] = ind1                    
> @@ -141,12 +144,12 @@
>                 pos = i
>                 while 1:
>                     old.append(pos)
> -                    if pos in link.keys() and link[pos] not in old:
> +                    if pos in list(link.keys()) and link[pos] not in old:
>                         pos = link[pos]
> -                    elif pos in rlink.keys() and rlink[pos] not in old:
> +                    elif pos in list(rlink.keys()) and rlink[pos] not in old:
>                         pos = rlink[pos]
>                     elif pos != i+1:
> -                        raise WrongFermionFlow, 'Not coherent Incoming/outcoming fermion flow'
> +                        raise WrongFermionFlow('Not coherent Incoming/outcoming fermion flow')
>                     elif pos == i+1:
>                         break
> 
> 
> === modified file 'aloha/aloha_lib.py'
> --- aloha/aloha_lib.py	2017-08-29 10:43:30 +0000
> +++ aloha/aloha_lib.py	2021-03-24 10:12:56 +0000
> @@ -43,12 +43,15 @@
> 
> 
> from __future__ import division
> +from __future__ import absolute_import
> +from __future__ import print_function
> from array import array
> import collections
> from fractions import Fraction
> import numbers
> import re
> import aloha # define mode of writting
> +from six.moves import range
> 
> try:
>     import madgraph.various.misc as misc
> @@ -143,13 +146,13 @@
>             if isinstance(expression, (MultLorentz, AddVariable, LorentzObject)):
>                 try:
>                     expr = expression.expand().get_rep([0])
> -                except KeyError, error:
> +                except KeyError as error:
>                     if error.args != ((0,),):
>                         raise
>                     else:
> -                        raise aloha.ALOHAERROR, '''Error in input format. 
> +                        raise aloha.ALOHAERROR('''Error in input format. 
>     Argument of function (or denominator) should be scalar.
> -    We found %s''' % expression
> +    We found %s''' % expression)
>                 new = expr.simplify()
>                 if not isinstance(new, numbers.Number):
>                     new = new.factorize()
> @@ -171,10 +174,10 @@
>             else:
>                 module = 'cmath.'
>             try:
> -                return str(eval("%s%s(%s)" % (module,fct_tag, ','.join(`x` for x in argument))))
> -            except Exception, error:
> -                print error
> -                print "cmath.%s(%s)" % (fct_tag, ','.join(`x` for x in argument))
> +                return str(eval("%s%s(%s)" % (module,fct_tag, ','.join(repr(x) for x in argument))))
> +            except Exception as error:
> +                print(error)
> +                print("cmath.%s(%s)" % (fct_tag, ','.join(repr(x) for x in argument)))
>         if str(fct_tag)+str(argument) in self.inverted_fct:
>             tag = self.inverted_fct[str(fct_tag)+str(argument)]
>             v = tag.split('(')[1][:-1]
> @@ -223,7 +226,7 @@
>             if not hasattr(term, 'vartype'):
>                 if isinstance(term, dict):
>                     # allow term of type{(0,):x}
> -                    assert term.values() == [0]
> +                    assert list(term.values()) == [0]
>                     term = term[(0,)]
>                 constant += term
>                 del self[pos]
> @@ -265,7 +268,7 @@
>                 else:
>                     nbminus += 1
>         if countprefact and max(countprefact.values()) >1:
> -            fact_prefactor = sorted(countprefact.items(), key=lambda x: x[1], reverse=True)[0][0]
> +            fact_prefactor = sorted(list(countprefact.items()), key=lambda x: x[1], reverse=True)[0][0]
>         else:
>             fact_prefactor = 1
>         if nbplus < nbminus:
> @@ -560,7 +563,7 @@
>                 else:
>                     nbminus += 1
> 
> -            newadd.prefactor = sorted(countprefact.items(), key=lambda x: x[1], reverse=True)[0][0]
> +            newadd.prefactor = sorted(list(countprefact.items()), key=lambda x: x[1], reverse=True)[0][0]
>             if nbplus < nbminus:
>                 newadd.prefactor *= -1
>             if newadd.prefactor != 1:
> @@ -621,7 +624,7 @@
>         """ initialization of the object with default value """        
>         #array.__init__(self, 'i', old) <- done already in new !!
>         self.prefactor = prefactor
> -        assert isinstance(self.prefactor, (float,int,long,complex))
> +        assert isinstance(self.prefactor, (float,int,int,complex))
> 
>     def get_id(self):
>         assert len(self) == 1
> @@ -684,7 +687,7 @@
> #                    self.append(new_id)
> #            return self
>         else:
> -            raise Exception, 'Cann\'t replace a Variable by %s' % type(expression)
> +            raise Exception('Cann\'t replace a Variable by %s' % type(expression))
> 
> 
>     def get_all_var_names(self):
> @@ -785,7 +788,7 @@
>             text = '(%s)' % (' * '.join(t))
>         return text
> 
> -    __rep__ = __str__
> +    __repr__ = __str__
> 
>     def factorize(self):
>         return self
> @@ -1457,12 +1460,14 @@
>         else:
>             # Special case for Scalar object
>             self.data = 0
> -            self.next = self.nextscalar
> 
>     def __iter__(self):
>         return self
> 
> -    def next(self):
> +    def __next__(self):
> +        if not self.len:
> +            return self.nextscalar()
> +
>         for i in range(self.len):
>             if self.data[i] < 3:
>                 self.data[i] += 1
> @@ -1470,6 +1475,8 @@
>             else:
>                 self.data[i] = 0
>         raise StopIteration
> +    #Python2
> +    next = __next__
> 
>     def nextscalar(self):
>         if self.data:
> @@ -1495,6 +1502,6 @@
>     import cProfile
>     def create():
>         for i in range(10000):
> -            LorentzObjectRepresentation.compare_indices(range(i%10),[4,3,5])       
> +            LorentzObjectRepresentation.compare_indices(list(range(i%10)),[4,3,5])       
> 
>     cProfile.run('create()')
> 
> === modified file 'aloha/aloha_object.py'
> --- aloha/aloha_object.py	2020-01-09 16:39:38 +0000
> +++ aloha/aloha_object.py	2021-03-24 10:12:56 +0000
> @@ -30,9 +30,11 @@
> ##
> ################################################################################
> from __future__ import division
> +from __future__ import absolute_import
> import aloha.aloha_lib as aloha_lib
> import aloha
> import cmath
> +from six.moves import range
> 
> #===============================================================================
> # P (Momenta)
> @@ -1018,7 +1020,8 @@
> 
>     @classmethod
>     def get_unique_name(cls,l1,l2):
> -        if l1<l2:
> +
> +        if str(l1)<str(l2):
>             return '_ETA_%s_%s' % (l1,l2)
>         else:
>             return '_ETA_%s_%s' % (l2,l1)
> 
> === modified file 'aloha/aloha_parsers.py'
> --- aloha/aloha_parsers.py	2020-01-09 16:39:38 +0000
> +++ aloha/aloha_parsers.py	2021-03-24 10:12:56 +0000
> @@ -19,18 +19,22 @@
> 
> from __future__ import division
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import logging
> import numbers
> import os
> import re
> import sys
> +from six.moves import input
> +from six.moves import range
> 
> 
> root_path = os.path.split(os.path.dirname(os.path.realpath( __file__ )))[0]
> sys.path.append(os.path.join(root_path))
> 
> -import aloha_lib
> -from aloha_object import *
> +from . import aloha_lib
> +from .aloha_object import *
> import vendor.ply.lex as lex
> import vendor.ply.yacc as yacc
> from aloha.aloha_lib import KERNEL
> @@ -175,27 +179,13 @@
>         "expression : group"
>         p[0] = p[1]
> 
> -    def p_expression_function1(self, p):
> -        "expression : FUNCTION '(' expression ')'"
> -        p1 = p[1]
> -        re_groups = self.re_cmath_function.match(p1)
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -        p[0] = p1 + '(' + p[3] + ')'
> -
> -    def p_expression_function2(self, p):
> -        "expression : FUNCTION '(' expression ',' expression ')'"
> -        p1 = p[1]
> -        re_groups = self.re_cmath_function.match(p1)
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -        p[0] = p1 + '(' + p[3] + ',' + p[5] + ')'
> 
>     def p_error(self, p):
>         if p:
>             try:
> -                print p
> -                print p[:]
> +                print(p)
> +                print(p[:])
> +                print(p.value)
>             except:
>                 pass
>             raise Exception("Syntax error at '%s' in '%s'" % (p.value, self.f))
> @@ -208,7 +198,7 @@
> 
>     aloha_object = ['P', 'PBar', 'PVec','Gamma','Gamma5','Sigma','Mass','PSlash',
>                     'OverMass2','Width','Scalar','Spinor','Vector',
> -                    'Spin2','Spin32','C','Epsilon','Metric','Identity',
> +                    'Spin2','Spin32','C','Epsilon','Metric','Identity', 'IdentityL',
>                     'ProjM','ProjP','Coup','Norm', 'EPSL', 'EPST1', 'EPST2', 'PT',
>                     'UFP', 'UFM', 'UFPC', 'UFMC',
>                     'VFP', 'VFM', 'VFPC', 'VFMC',
> @@ -227,7 +217,8 @@
>             obj = p[1].split('(',1)[0]
> 
>         if obj in self.aloha_object:
> -            p[0] = ''.join(p[1:])
> +            p2 = [x for i,x in enumerate(p) if i>0]
> +            p[0] = ''.join(p2)
>         else:
>              new = aloha_lib.KERNEL.add_function_expression('pow', eval(p[1]), eval(p[3]))
>              p[0] = str(new)
> @@ -268,63 +259,40 @@
>         new = aloha_lib.KERNEL.add_function_expression(p[1], eval(p[2])) 
>         p[0] = str(new)
> 
> -    def p_expression_function1(self, p):
> -        "expression : FUNCTION '(' expression ')'"
> -        
> -        p1 = p[1]
> -        if p1 in self.aloha_object:
> -            p[0] = p[1]+'('+p[3]+')'
> -            return 
> -        re_groups = self.re_cmath_function.match(p1)
> -        
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -        new = aloha_lib.KERNEL.add_function_expression(p1, eval(p[3]))
> -        p[0] = str(new)
> -    
> -    def p_expression_function2(self, p):
> -        "expression : FUNCTION '(' expression ',' expression ')'"
> -        
> -        if p[1] in self.aloha_object:
> -            p[0] = p[1]+'('+p[3]+','+ p[5]+')'
> -            return
> -        
> -        p1 = p[1]
> -        re_groups = self.re_cmath_function.match(p1)
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -        new = aloha_lib.KERNEL.add_function_expression(p1, eval(p[3]), eval(p[5]))
> -        p[0] = str(new)
> -    
> -    def p_expression_function3(self, p):
> -        "expression : FUNCTION '(' expression ',' expression ',' expression ')'"
> -        
> -        if p[1] in self.aloha_object:
> -            p[0] = p[1]+'('+p[3]+','+ p[5]+','+p[7]+')'
> -            return
> -        
> -        p1 = p[1]
> -        re_groups = self.re_cmath_function.match(p1)
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -
> -        new = aloha_lib.KERNEL.add_function_expression(p1, eval(p[3]), eval(p[5]),eval(p[7]))
> -        p[0] = str(new)
> -
> -    def p_expression_function4(self, p):
> -        "expression : FUNCTION '(' expression ',' expression ',' expression ',' expression ')'"
> -        if p[1] in self.aloha_object:
> -            p[0] = p[1]+'('+p[3]+','+ p[5]+','+ p[7]+','+ p[9]+')'            
> -            return
> -        
> -        p1 = p[1]
> -        re_groups = self.re_cmath_function.match(p1)
> -        if re_groups:
> -            p1 = re_groups.group("name")
> -        args = [eval(p[2*i+1]) for i in [1,2,3,4]]
> +    def p_expression_function(self, p):
> +        """expression : FUNCTION '(' expression ')'
> +         expression : FUNCTION '(' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression  ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         expression : FUNCTION '(' expression ',' expression  ',' expression ',' expression ',' expression ',' expression  ',' expression  ',' expression ',' expression ',' expression  ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ',' expression ')'
> +         """
> +        if p[1] in self.aloha_object:
> +            p[0] = ''.join(p[1:])
> +            return
> +         
> +        p1 = p[1]
> +        re_groups = self.re_cmath_function.match(p1)
> +        if re_groups:
> +            p1 = re_groups.group("name")
> +        args = [eval(p[2*i+1]) for i in range(1, len(p)//2)]
>         new = aloha_lib.KERNEL.add_function_expression(p1, *args)
>         p[0] = str(new)
> -    
> +
>     def p_expression_binop(self, p):
>         '''expression : expression '=' expression
>                       | expression '+' expression
> @@ -351,7 +319,7 @@
>     calc = ALOHAExpressionParser()
>     while 1:
>         try:
> -            s = raw_input('calc > ')
> +            s = input('calc > ')
>         except EOFError:
>             break
>         if not s: continue
> 
> === modified file 'aloha/aloha_writers.py'
> --- aloha/aloha_writers.py	2020-01-09 23:14:56 +0000
> +++ aloha/aloha_writers.py	2021-03-24 10:12:56 +0000
> @@ -1,3 +1,5 @@
> +from __future__ import absolute_import
> +from six.moves import range
> try:
>     import madgraph.iolibs.file_writers as writers 
>     import madgraph.various.q_polynomial as q_polynomial
> @@ -16,7 +18,7 @@
> from collections import defaultdict
> from fractions import Fraction
> # fast way to deal with string
> -from cStringIO import StringIO
> +from six import StringIO
> # Look at http://www.skymind.com/~ocrow/python_string/ 
> # For knowing how to deal with long strings efficiently.
> import itertools
> @@ -92,12 +94,12 @@
>         elif len(indices) == 2: 
>             return  4 * indices[0] + indices[1] + start + self.momentum_size
>         else:
> -            raise Exception, 'WRONG CONTRACTION OF LORENTZ OBJECT for routine %s: %s' \
> -                    % (self.name, ind_name)                                 
> +            raise Exception('WRONG CONTRACTION OF LORENTZ OBJECT for routine %s: %s' \
> +                    % (self.name, ind_name))                                 
> 
>     def get_header_txt(self,mode=''): 
>         """ Prototype for language specific header""" 
> -        raise Exception, 'THis function should be overwritten'
> +        raise Exception('THis function should be overwritten')
>         return ''
> 
>     def get_declaration_txt(self):
> @@ -110,7 +112,7 @@
> 
>     def get_momenta_txt(self):
>         """ Prototype for the definition of the momenta"""
> -        raise Exception, 'THis function should be overwritten'
> +        raise Exception('THis function should be overwritten')
> 
>     def get_momentum_conservation_sign(self):
>         """find the sign associated to the momentum conservation"""
> @@ -208,19 +210,20 @@
>         # couplings
>         if  couplings is None:
>             detected_couplings = [name for type, name in self.declaration if name.startswith('COUP')]
> -            coup_sort = lambda x,y: int(x[4:])-int(y[4:])
> -            detected_couplings.sort(coup_sort)
> +            detected_couplings.sort(key=lambda x: x[4:])
>             if detected_couplings:
>                 couplings = detected_couplings
>             else:
>                 couplings = ['COUP']
> 
> -        for coup in couplings:       
> +        for coup in couplings:   
>             call_arg.append(('complex', coup))              
>             self.declaration.add(('complex',coup))
> 
>         if self.offshell:
> -            if aloha.complex_mass:
> +            if 'P1N' in self.tag:
> +                pass
> +            elif aloha.complex_mass:
>                 call_arg.append(('complex','M%s' % self.outgoing))              
>                 self.declaration.add(('complex','M%s' % self.outgoing))
>             else:
> @@ -532,7 +535,9 @@
>                     (self.change_number_format(0),self.change_number_format(1)))
>         if KERNEL.has_pi:
>             out.write(' parameter (PI=%s)\n' % self.change_number_format(cmath.pi))
> -        for type, name in self.declaration:
> +        
> +        
> +        for type, name in self.declaration.tolist():
>             if type.startswith('list'):
>                 type = type[5:]
>                 #determine the size of the list
> @@ -587,7 +592,7 @@
>         """Define the Header of the fortran file. This include
>             - momentum conservation
>             - definition of the impulsion"""
> -                    
> +                        
>         out = StringIO()
> 
>         # Define all the required momenta
> @@ -609,11 +614,15 @@
> 
>             if self.declaration.is_used('P%s' % (i+1)):
>                 self.get_one_momenta_def(i+1, out)
> -                
> +        
>         # define the resulting momenta
> -        if self.offshell:
> -            
> -            
> +        bypass = False
> +        if 'P1N' in self.tag:
> +            if  not self.declaration.is_used('P%s' % (self.outgoing)):
> +                bypass = True
> +
> +        if self.offshell and not bypass:
> +
>             energy_pos = out_size -2
>             type = self.particles[self.outgoing-1]
> 
> @@ -752,7 +761,10 @@
>         out = StringIO()
> 
>         if self.routine.contracted:
> -            for name,obj in self.routine.contracted.items():
> +            all_keys = list(self.routine.contracted.keys())
> +            all_keys.sort()
> +            for name in all_keys:
> +                obj = self.routine.contracted[name]
>                 out.write(' %s = %s\n' % (name, self.write_obj(obj)))
>                 self.declaration.add(('complex', name))
> 
> @@ -767,8 +779,8 @@
>             else:
>                 return +1
> 
> -        keys = self.routine.fct.keys()        
> -        keys.sort(sort_fct)
> +        keys = list(self.routine.fct.keys())        
> +        keys.sort(key=misc.cmp_to_key(sort_fct))
>         for name in keys:
>             fct, objs = self.routine.fct[name]
>             format = ' %s = %s\n' % (name, self.get_fct_format(fct))
> @@ -781,12 +793,14 @@
> 
> 
>         numerator = self.routine.expr
> +
>         if not 'Coup(1)' in self.routine.infostr:
>             coup_name = 'COUP'
>         else:
>             coup_name = '%s' % self.change_number_format(1)
> -        
> -        
> +
> +        
> +        misc.sprint(self.name, coup_name, cond="VVS11_14P1N" in self.name)
>         if not self.offshell:
>             if coup_name == 'COUP':
>                 formatted = self.write_obj(numerator.get_rep([0]))
> @@ -810,23 +824,29 @@
>                 coeff = 'denom*'    
>                 if not aloha.complex_mass:
>                     if self.routine.denominator:
> -                        out.write('    denom = %(COUP)s/(%(denom)s)\n' % {'COUP': coup_name,\
> +                        if 'P1N' not in self.tag:
> +                            out.write('    denom = %(COUP)s/(%(denom)s)\n' % {'COUP': coup_name,\
>                                 'denom':self.write_obj(self.routine.denominator)}) 
>                     else:
>                         out.write('    denom = %(COUP)s/(P%(i)s(0)**2-P%(i)s(1)**2-P%(i)s(2)**2-P%(i)s(3)**2 - M%(i)s * (M%(i)s -CI* W%(i)s))\n' % \
>                                   {'i': self.outgoing, 'COUP': coup_name})
>                 else:
>                     if self.routine.denominator:
> -                        raise Exception, 'modify denominator are not compatible with complex mass scheme'                
> -
> -                    out.write('    denom = %(COUP)s/(P%(i)s(0)**2-P%(i)s(1)**2-P%(i)s(2)**2-P%(i)s(3)**2 - M%(i)s**2)\n' % \
> +                        if 'P1N' not in self.tag:
> +                            raise Exception('modify denominator are not compatible with complex mass scheme', self.tag)                
> +                    if 'P1N' not in self.tag:
> +                        out.write('    denom = %(COUP)s/(P%(i)s(0)**2-P%(i)s(1)**2-P%(i)s(2)**2-P%(i)s(3)**2 - M%(i)s**2)\n' % \
>                       {'i': self.outgoing, 'COUP': coup_name})
> -                self.declaration.add(('complex','denom'))
> +                if 'P1N' not in self.tag:
> +                    self.declaration.add(('complex','denom'))
>                 if aloha.loop_mode:
>                     ptype = 'list_complex'
>                 else:
>                     ptype = 'list_double'
> -                self.declaration.add((ptype,'P%s' % self.outgoing))
> +                if 'P1N' not in self.tag:
> +                    self.declaration.add((ptype,'P%s' % self.outgoing))
> +                else:
> +                    coeff = '%(COUP)s*' % {'COUP': coup_name}  
>             else:
>                 if coup_name == 'COUP':
>                     coeff = 'COUP*'
> @@ -846,7 +866,7 @@
>                 to_order[self.pass_to_HELAS(ind)] = \
>                         '    %s(%d)= %s%s\n' % (self.outname, self.pass_to_HELAS(ind)+1, 
>                         coeff, formatted)
> -            key = to_order.keys()
> +            key = list(to_order.keys())
>             key.sort()
>             for i in key:
>                 out.write(to_order[i])
> @@ -1006,7 +1026,7 @@
>                     expr = self.routine.expr[tuple(arg)]
>                 except KeyError:
>                     expr = None
> -                for ind in self.routine.expr.values()[0].listindices():
> +                for ind in list(self.routine.expr.values())[0].listindices():
>                     if expr:
>                         data = expr.get_rep(ind)
>                     else:
> @@ -1096,8 +1116,8 @@
>         # couplings
>         if couplings is None:
>             detected_couplings = [name for type, name in self.declaration if name.startswith('COUP')]
> -            coup_sort = lambda x,y: int(x[4:])-int(y[4:])
> -            detected_couplings.sort(coup_sort)
> +            coup_sort = lambda x,y: int(x[4:])-int(y[4:])  
> +            detected_couplings.sort(key=lambda x: int(x[4:]) if x[4:] else 0 )
>             if detected_couplings:
>                 couplings = detected_couplings
>             else:
> @@ -1241,12 +1261,15 @@
>     """ build the name for combined aloha function """
> 
>     def myHash(target_string):
> +        suffix = ''
> +        if '%(propa)s' in target_string:
> +            target_string = target_string.replace('%(propa)s','')
> +            suffix = '%(propa)s'
> +            
>         if len(target_string)<50:
> -            return target_string
> -        if '%(propa)s' in target_string:
> -            return 'ALOHA_'+(str(hash(target_string.lower()))).replace('-','m')+'%(propa)s'
> +            return '%s%s' % (target_string, suffix)
>         else:
> -            return 'ALOHA_'+(str(hash(target_string.lower()))).replace('-','m')
> +            return 'ALOHA_%s%s' % (str(hash(target_string.lower())).replace('-','m'), suffix)
> 
>     if tag and any(t.startswith('P') for t in tag[:-1]):
>         # propagator need to be the last entry for the tag
> @@ -1467,7 +1490,7 @@
>         if add_i:
>             out.write(self.ci_definition)
> 
> -        for type, name in self.declaration:
> +        for type, name in self.declaration.tolist():
>             if type.startswith('list'):
>                 type = type[5:]
>                 if name.startswith('P'):
> @@ -1589,7 +1612,7 @@
>             for name,obj in self.routine.contracted.items():
>                 out.write(' %s = %s;\n' % (name, self.write_obj(obj)))
>                 self.declaration.add(('complex', name))
> -                
> +        
>         for name, (fct, objs) in self.routine.fct.items():
>             format = ' %s = %s;\n' % (name, self.get_fct_format(fct))
>             out.write(format % ','.join([self.write_obj(obj) for obj in objs]))
> @@ -1620,10 +1643,11 @@
>                       {'i': self.outgoing, 'coup': coup_name})
>                 else:
>                     if self.routine.denominator:
> -                        raise Exception, 'modify denominator are not compatible with complex mass scheme'                
> +                        raise Exception('modify denominator are not compatible with complex mass scheme')                
> 
>                     out.write('    denom = %(coup)s/((P%(i)s[0]*P%(i)s[0])-(P%(i)s[1]*P%(i)s[1])-(P%(i)s[2]*P%(i)s[2])-(P%(i)s[3]*P%(i)s[3]) - (M%(i)s*M%(i)s));\n' % \
>                       {'i': self.outgoing, 'coup': coup_name})
> +
>                 self.declaration.add(('complex','denom'))
>                 if aloha.loop_mode:
>                     ptype = 'list_complex'
> @@ -1942,7 +1966,7 @@
>             self.declaration.add(('fct', fct))
>             return 'cmath.{0}(%s)'.format(fct)
>         else:
> -            raise Exception, "Unable to handle function name %s (no special rule defined and not in cmath)" % fct
> +            raise Exception("Unable to handle function name %s (no special rule defined and not in cmath)" % fct)
> 
>     def define_expression(self):
>         """Define the functions in a 100% way """
> @@ -1950,7 +1974,11 @@
>         out = StringIO()
> 
>         if self.routine.contracted:
> -            for name,obj in self.routine.contracted.items():
> +            keys = list( self.routine.contracted.keys())
> +            keys.sort()
> +            
> +            for name in keys:
> +                obj = self.routine.contracted[name]
>                 out.write('    %s = %s\n' % (name, self.write_obj(obj)))
> 
>         def sort_fct(a, b):
> @@ -1963,8 +1991,8 @@
>             else:
>                 return +1
> 
> -        keys = self.routine.fct.keys()        
> -        keys.sort(sort_fct)
> +        keys = list(self.routine.fct.keys())        
> +        keys.sort(key=misc.cmp_to_key(sort_fct))
>         for name in keys:
>             fct, objs = self.routine.fct[name]
>             format = '    %s = %s\n' % (name, self.get_fct_format(fct))
> @@ -2003,7 +2031,7 @@
>                           {'i': self.outgoing,'coup':coup_name})
>                 else:
>                     if self.routine.denominator:
> -                        raise Exception, 'modify denominator are not compatible with complex mass scheme'                
> +                        raise Exception('modify denominator are not compatible with complex mass scheme')                
> 
>                     out.write('    denom = %(coup)s/(P%(i)s[0]**2-P%(i)s[1]**2-P%(i)s[2]**2-P%(i)s[3]**2 - M%(i)s**2)\n' % 
>                           {'i': self.outgoing,'coup':coup_name})                    
> @@ -2228,6 +2256,13 @@
> 
>         set.add(self,obj)
> 
> +    def tolist(self):
> +
> +        out = list(self)
> +        out.sort(key=lambda n:n[1])
> +        return out
> +    
> +        
> 
> class WriterFactory(object):
> 
> @@ -2251,7 +2286,7 @@
>         elif language == 'gpu':
>             return ALOHAWriterForGPU(data, outputdir)
>         else:
> -            raise Exception, 'Unknown output format'
> +            raise Exception('Unknown output format')
> 
> 
> 
> 
> === modified file 'aloha/create_aloha.py'
> --- aloha/create_aloha.py	2020-06-21 21:31:33 +0000
> +++ aloha/create_aloha.py	2021-03-24 10:12:56 +0000
> @@ -13,9 +13,11 @@
> #
> ################################################################################
> from __future__ import division
> +from __future__ import absolute_import
> import cmath
> import copy
> -import cPickle
> +import operator
> +import six.moves.cPickle
> import glob
> import logging
> import numbers
> @@ -26,6 +28,9 @@
> import time
> from madgraph.interface.tutorial_text import output
> 
> +from six.moves import range
> +from six.moves import zip
> +
> root_path = os.path.split(os.path.dirname(os.path.realpath( __file__ )))[0]
> sys.path.append(root_path)
> from aloha.aloha_object import *
> @@ -35,13 +40,15 @@
> import aloha.aloha_object as aloha_object
> import aloha.aloha_parsers as aloha_parsers
> import aloha.aloha_fct as aloha_fct
> +import models
> try:
>     import madgraph.iolibs.files as files
>     import madgraph.various.misc as misc
> except Exception:
>     import aloha.files as files
>     import aloha.misc as misc
> -    
> +
> +   
> aloha_path = os.path.dirname(os.path.realpath(__file__))
> logger = logging.getLogger('ALOHA')
> 
> @@ -110,7 +117,7 @@
>                 rank = max(sum(coeff), rank)
>             return rank -1 # due to the coefficient associate to the wavefunctions
>         else:
> -            raise ALOHAERROR, '%s is not a valid information that can be computed' % info
> +            raise ALOHAERROR('%s is not a valid information that can be computed' % info)
> 
> 
> class AbstractRoutineBuilder(object):
> @@ -191,7 +198,7 @@
>     def apply_conjugation(self, pair=1):
>         """ apply conjugation on self object"""
> 
> -        nb_fermion = len([1 for s in self.spins if s % 2 == 0])   
> +        nb_fermion = len([1 for s in self.spins if s % 2 == 0])  
>         if isinstance(pair, tuple):
>             if len(pair) ==1 :
>                 pair = pair[0]
> @@ -206,7 +213,7 @@
>             if not data == target:
>                 text = """Unable to deal with 4(or more) point interactions
> in presence of majorana particle/flow violation"""
> -                raise ALOHAERROR, text
> +                raise ALOHAERROR(text)
> 
>         old_id = 2 * pair - 1
>         new_id = _conjugate_gap + old_id
> @@ -286,7 +293,7 @@
>                 lorentz = eval(lorentz)
>             except NameError as error:
>                 logger.error('unknow type in Lorentz Evaluation:%s'%str(error))
> -                raise ALOHAERROR, 'unknow type in Lorentz Evaluation: %s ' % str(error) 
> +                raise ALOHAERROR('unknow type in Lorentz Evaluation: %s ' % str(error)) 
>             else:
>                 self.kernel_tag = set(aloha_lib.KERNEL.use_tag)
>         elif isinstance(self.routine_kernel,str):
> @@ -304,7 +311,6 @@
>                 propa = [t[1:] for t in self.tag if t.startswith('P')]
>                 if propa == ['0']: 
>                     if spin == 3 and aloha.unitary_gauge == 2:
> -                        misc.sprint(spin)
>                         lorentz *= complex(0,1) * self.get_custom_propa('1PS', spin, id)
>                         continue
>                     else:
> @@ -474,6 +480,12 @@
>         elif propa == "1PS":
>             numerator = "(-1*(P(-1,id)*PBar(-1,id)) * Metric(1, 2) + P(1,id)*PBar(2,id) + PBar(1,id)*P(2,id))"
>             denominator = "(P(-3,id)*PBar(-3,id))*P(-2,id)**2"
> +        elif propa == "1N":
> +            if spin == 3:
> +                numerator = '-1*IdentityL(1,2)'
> +            else:
> +                numerator = "-1"
> +            denominator = "1"
>         else:
>             raise Exception
> 
> @@ -531,6 +543,7 @@
>             return eval(numerator) * propaR
>         else:
>             return eval(numerator)
> +        
> 
> 
> 
> @@ -659,7 +672,6 @@
> 
>         # Option
>         self.explicit_combine = explicit_combine
> -        
>         # Extract the model name if combined with restriction
>         model_name_pattern = re.compile("^(?P<name>.+)-(?P<rest>[\w\d_]+)$")
>         model_name_re = model_name_pattern.match(model_name)
> @@ -670,15 +682,16 @@
>                os.path.isfile(os.path.join(root_path, "models", name,
>                                            "restrict_%s.dat" % rest)):
>                 model_name = model_name_re.group("name")
> -
>         # load the UFO model
> -        try:
> -            python_pos = model_name 
> -            __import__(python_pos)
> -        except Exception:
> -            python_pos = 'models.%s' % model_name 
> -            __import__(python_pos)
> -        self.model = sys.modules[python_pos]
> +        self.model = models.load_model(model_name)
> +#         
> +#         try:
> +#             python_pos = model_name 
> +#             __import__(python_pos)
> +#         except Exception:
> +#             python_pos = 'models.%s' % model_name 
> +#             __import__(python_pos)
> +#         self.model = sys.modules[python_pos]
>         # find the position on the disk
>         self.model_pos = os.path.dirname(self.model.__file__)
> 
> @@ -730,8 +743,12 @@
>             filepos = os.path.join(self.model_pos,'aloha.pkl') 
> 
>         fsock = open(filepos, 'w')
> -        cPickle.dump(dict(self), fsock)
> -        
> +        t=dict(self)
> +        try:
> +            six.moves.cPickle.dump(dict(self), fsock)
> +        except:
> +            logger.info('aloha not saved')
> +            
>     def load(self, filepos=None):
>         """ reload the pickle file """
>         return False
> @@ -739,7 +756,7 @@
>             filepos = os.path.join(self.model_pos,'aloha.pkl') 
>         if os.path.exists(filepos):
>             fsock = open(filepos, 'r')
> -            self.update(cPickle.load(fsock))        
> +            self.update(six.moves.cPickle.load(fsock))        
>             return True
>         else:
>             return False
> @@ -777,13 +794,20 @@
>         if hasattr(self, 'cached_interaction_infos'):
>             # Now try to recover it
>             for info_key in infos:
> +                all_done = True
>                 try:
>                     returned_dict[info] = self.cached_interaction_infos[\
>                                          (lorentzname,outgoing,tuple(tag),info)]
>                 except KeyError:
>                     # Some information has never been computed before, so they
>                     # will be computed later.
> -                    pass             
> +                    all_done = False
> +                    pass
> +            if all_done:             
> +                if isinstance(info, str):
> +                    return returned_dict[info]
> +                else:
> +                    return returned_dict
>         elif cached:
>             self.cached_interaction_infos = {}
> 
> @@ -880,7 +904,7 @@
>                                 realname = conjg_builder.name + ''.join(['C%s' % pair for pair in conjg_builder.conjg])
>                                 try:
>                                     self[(realname, outgoing)].add_combine(m)
> -                                except Exception,error:
> +                                except Exception as error:
>                                     self[(realname, self.symmetries[lorentz.name][outgoing])].add_combine(m)          
> 
>         if save:
> @@ -910,7 +934,20 @@
>         # self.explicit_combine = False
>         request = {}
> 
> +        #handle special outgoing=-1 flag (which means do it for all particle outgoing)
> +        # use for P1N
> +        for list_l_name, tag, outgoing in data[:]:
> +            if outgoing == -1: #means do for all particle.
> +                data.remove((list_l_name, tag, outgoing))
> +                l_name = list_l_name[0]
> +                lorentz = eval('self.model.lorentz.%s' % l_name)
> +                for i in range(len(lorentz.spins)):
> +                    data.append((list_l_name, tag, i+1))
> +                
> +                
> +
>         for list_l_name, tag, outgoing in data:
> +            
>             #allow tag to have integer for retro-compatibility
>             all_tag = tag[:]
>             conjugate = [i for i in tag if isinstance(i, int)]
> @@ -919,7 +956,7 @@
>             tag = tag + ['C%s'%i for i in conjugate]             
>             tag = tag + [i for i in all_tag if isinstance(i, str) and  i.startswith('P')] 
> 
> -            conjugate = tuple([int(c[1:]) for c in tag if c.startswith('C')])
> +            conjugate = tuple([int(float(c[1:])) for c in tag if c.startswith('C')])
>             loop = any((t.startswith('L') for t in tag))
>             if loop:
>                 aloha.loop_mode = True
> @@ -954,7 +991,7 @@
>                     if a[0] < b[0]: return -1
>                     else: return 1
>                 routines = request[l_name][conjg]
> -                routines.sort(sorting)
> +                routines.sort(key=misc.cmp_to_key(sorting))
>                 if not conjg:
>                     # No need to conjugate -> compute directly
>                     self.compute_aloha(builder, routines=routines)
> @@ -980,7 +1017,7 @@
>             if not self.explicit_combine:
>                 lorentzname = list_l_name[0]
>                 lorentzname += ''.join(tag)
> -                if self.has_key((lorentzname, outgoing)):
> +                if (lorentzname, outgoing) in self:
>                     self[(lorentzname, outgoing)].add_combine(list_l_name[1:])
>                 else:
>                     lorentz = eval('self.model.lorentz.%s' % list_l_name[0])
> @@ -997,7 +1034,7 @@
>                         if a[0] < b[0]: return -1
>                         else: return 1
>                     routines = request[list_l_name[0]][conjg]
> -                    routines.sort(sorting)
> +                    routines.sort(key=operator.itemgetter(0))
>                     if not conjg:
>                         # No need to conjugate -> compute directly
>                         self.compute_aloha(builder, routines=routines)
> @@ -1099,18 +1136,20 @@
> 
>         ext_files  = []
>         for path in paths:
> -            ext_files = misc.glob('%s.%s' % (name, ext), path)
> +            base, amp = name.rsplit('_',1)
> +            ext_files = misc.glob('%s*_%s.%s' % (base,amp, ext), path)
>             if ext_files:
>                 break
>         else: 
> 
> -            raise ALOHAERROR, 'No external routine \"%s.%s\" in directories\n %s' % \
> -                        (name, ext, '\n'.join(paths))
> +            raise ALOHAERROR('No external routine \"%s.%s\" in directories\n %s' % \
> +                        (name, ext, '\n'.join(paths)))
> 
>         if output_dir:
>             for filepath in ext_files:
> 
>                 files.cp(filepath, output_dir)
> +
>         return ext_files
> 
> 
> @@ -1128,8 +1167,8 @@
>                         if part1.spin == 2 and (i % 2 != j % 2 ):
>                             continue 
>                         for lorentz in vertex.lorentz:
> -                            if self.symmetries.has_key(lorentz.name):
> -                                if self.symmetries[lorentz.name].has_key(i+1):
> +                            if lorentz.name in self.symmetries:
> +                                if i+1 in self.symmetries[lorentz.name]:
>                                     self.symmetries[lorentz.name][i+1] = max(self.symmetries[lorentz.name][i+1], j+1)
>                                 else:
>                                     self.symmetries[lorentz.name][i+1] = j+1
> @@ -1270,7 +1309,7 @@
>     text +='\n'
> 
> 
> -    file(os.path.join(aloha_dir, 'aloha_file.inc'), 'w').write(text) 
> +    open(os.path.join(aloha_dir, 'aloha_file.inc'), 'w').write(text) 
> 
> 
> 
> 
> === modified file 'aloha/template_files/Makefile_F'
> --- aloha/template_files/Makefile_F	2016-03-02 03:03:20 +0000
> +++ aloha/template_files/Makefile_F	2021-03-24 10:12:56 +0000
> @@ -18,6 +18,8 @@
> 
> BASIC_OBJS = aloha_functions.o
> 
> +FFLAGS += $(ALOHA_FLAG)
> +
> include ./aloha_file.inc
> 
> all: $(LIBDIR)$(LIBRARY)
> 
> === modified file 'aloha/template_files/aloha_functions.f'
> --- aloha/template_files/aloha_functions.f	2013-11-29 07:28:53 +0000
> +++ aloha/template_files/aloha_functions.f	2021-03-24 10:12:56 +0000
> @@ -2036,4 +2036,37 @@
>       return
>       end
> 
> -
> +      subroutine CombineAmp(nb, ihels, iwfcts, W1, Wall, Amp)
> +
> +      integer nb ! size of the vectors
> +      integer ihels(*), iwfcts(*)
> +      double complex W1(6)
> +      double complex Wall(6,*)
> +      double complex Amp(*)
> +c     local variable
> +      integer i
> +
> +      do i = 1, nb
> +         Amp(ihels(i)) =  W1(3) * Wall(3,iwfcts(i)) +
> +     &                    W1(4) * Wall(4,iwfcts(i))+
> +     &                    W1(5) * Wall(5,iwfcts(i))+
> +     &                    W1(6) * Wall(6,iwfcts(i))
> +      enddo
> +      return
> +      end
> +      
> +      subroutine CombineAmpS(nb, ihels, iwfcts, W1, Wall, Amp)
> +
> +      integer nb ! size of the vectors
> +      integer ihels(*), iwfcts(*)
> +      double complex W1(3)
> +      double complex Wall(6,*)
> +      double complex Amp(*)
> +c     local variable
> +      integer i
> +
> +      do i = 1, nb
> +         Amp(ihels(i)) =  W1(3) * Wall(3,iwfcts(i))
> +      enddo
> +      return
> +      end
> 
> === modified file 'aloha/template_files/wavefunctions.py'
> --- aloha/template_files/wavefunctions.py	2015-11-10 11:23:55 +0000
> +++ aloha/template_files/wavefunctions.py	2021-03-24 10:12:56 +0000
> @@ -1,7 +1,9 @@
> from __future__ import division 
> +from __future__ import absolute_import
> import math
> from math import sqrt, pow
> from itertools import product
> +from six.moves import range
> 
> class WaveFunction(list):
>     """a objet for a WaveFunction"""
> @@ -335,7 +337,7 @@
>                 ft[(i,j)] = sqh*( em[i]*e0[j] + e0[i]*em[j] )
> 
>     else:
> -        raise Exception, 'invalid helicity TXXXXXX' 
> +        raise Exception('invalid helicity TXXXXXX') 
> 
> 
> 
> @@ -557,11 +559,11 @@
> 
>     # spin-3/2 fermion wavefunction
>     if nhel == 3:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             rc[(i, j)] = ep[i] *fip[j]
> 
>     elif nhel == 1:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i,j)] = sq2/sq3*e0[i]*fip[j] +1/sq3*ep[i]*fim[j]
>             elif cond2:
> @@ -570,7 +572,7 @@
>                 rc[(i,j)] = sq2/sq3*e0[i]*fip[j] + \
>                                    1/sq3*ep[i]*fim[j] *complex(p[1],nsr*p[2])/pt  
>     elif nhel == -1:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i,j)] = 1/sq3*em[i]*fip[j] +sq2/sq3*e0[i]*fim[j]
>             elif cond2:
> @@ -579,7 +581,7 @@
>                 rc[(i,j)] = 1/sq3*em[i]*fip[j] + \
>                                 sq2/sq3*e0[i]*fim[j] *complex(p[1],nsr*p[2])/pt  
>     else:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i, j)] = em[i] *fim[j]
>             elif cond2:
> @@ -820,12 +822,12 @@
> 
>     # spin-3/2 fermion wavefunction
>     if nhel == 3:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             rc[(i, j)] = ep[i] *fop[j]  
> 
> 
>     elif nhel == 1:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i,j)] = sq2/sq3*e0[i]*fop[j] + 1/sq3*ep[i]*fom[j]
>             elif cond2:
> @@ -835,7 +837,7 @@
>                                                       complex(p[1],-nsr*p[2])/pt  
> 
>     elif nhel == -1:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i,j)] = 1/sq3*em[i]*fop[j]+sq2/sq3*e0[i]*fom[j]
>             elif cond2:
> @@ -844,7 +846,7 @@
>                 rc[(i,j)] =  1/sq3*em[i]*fop[j] + sq2/sq3*e0[i]*fom[j] *\
>                                                       complex(p[1],-nsr*p[2])/pt              
>     else:
> -        for i,j in product(range(4), range(4)):
> +        for i,j in product(list(range(4)), list(range(4))):
>             if cond1:
>                 rc[(i,j)] = em[i] * fom[j]
>             elif cond2:
> 
> === modified file 'bin/compile.py'
> --- bin/compile.py	2017-02-20 10:15:41 +0000
> +++ bin/compile.py	2021-03-24 10:12:56 +0000
> @@ -13,6 +13,8 @@
> # For more information, visit madgraph.phys.ucl.ac.be and amcatnlo.web.cern.ch
> #
> ################################################################################
> +from __future__ import absolute_import
> +from __future__ import print_function
> import os
> import sys
> import logging
> @@ -90,13 +92,13 @@
>         for model_path in v4_model:
>             #remove old pkl
>             start = time.time()
> -            print 'make pkl for %s :' % os.path.basename(model_path),
> +            print('make pkl for %s :' % os.path.basename(model_path), end=' ')
>             try:
>                 os.remove(os.path.join(model_path,'model.pkl'))
>             except:
>                 pass
>             import_v4.import_model(model_path)
> -            print '%2fs' % (time.time() - start)
> +            print('%2fs' % (time.time() - start))
> 
>     @staticmethod
>     def make_UFO_pkl():
> @@ -109,20 +111,20 @@
>         # model.pkl
>         for model_path in ufo_model:
>             start = time.time()
> -            print 'make model.pkl for %s :' % os.path.basename(model_path),
> +            print('make model.pkl for %s :' % os.path.basename(model_path), end=' ')
>             #remove old pkl
>             try:
>                 os.remove(os.path.join(model_path,'model.pkl'))
>             except:
>                 pass
>             import_ufo.import_full_model(model_path)
> -            print '%2fs' % (time.time() - start)
> +            print('%2fs' % (time.time() - start))
> 
>         return
>         # aloha routine 
>         for model_path in ufo_model:
>             start = time.time()
> -            print 'make ALOHA for %s' % os.path.basename(model_path)
> +            print('make ALOHA for %s' % os.path.basename(model_path))
>             #remove old pkl
>             try:
>                 os.remove(os.path.join(model_path,'aloha.pkl'))
> @@ -137,11 +139,11 @@
>             sys.path.insert(0, ufo_path)
>             output_dir = os.path.join(model_path, 'Fortran')
>             create_aloha.AbstractALOHAModel(ufo_name, write_dir=output_dir, format='Fortran')
> -            print 'done in %2fs' % (time.time() - start)
> +            print('done in %2fs' % (time.time() - start))
> 
>     @staticmethod
>     def make_stdHep():
> -        print "Compiling StdHEP in %s."%str(os.path.join(MG5DIR, 'vendor', 'StdHEP'))
> +        print("Compiling StdHEP in %s."%str(os.path.join(MG5DIR, 'vendor', 'StdHEP')))
>         # this is for 64-bit systems
>         if sys.maxsize > 2**32:
>             path = os.path.join(MG5DIR, 'vendor', 'StdHEP', 'src', 'make_opts')
> @@ -171,7 +173,7 @@
> 
>     @staticmethod
>     def make_CutTools():
> -        print "Compiling CutTools in %s."%str(os.path.join(MG5DIR, 'vendor', 'CutTools'))
> +        print("Compiling CutTools in %s."%str(os.path.join(MG5DIR, 'vendor', 'CutTools')))
>         # Set the correct fortran compiler
>         if 'FC' not in os.environ or not os.environ['FC']:
>             if misc.which('gfortran'):
> @@ -193,7 +195,7 @@
> 
>     @staticmethod
>     def make_IREGI():
> -        print "Compiling IREGI in %s."%str(os.path.join(MG5DIR, 'vendor', 'IREGI','src'))
> +        print("Compiling IREGI in %s."%str(os.path.join(MG5DIR, 'vendor', 'IREGI','src')))
>         # Set the correct fortran compiler
>         if 'FC' not in os.environ or not os.environ['FC']:
>             if misc.which('gfortran'):
> @@ -276,9 +278,9 @@
>         misc.compile(cwd = os.path.join(iregi_path,'src'))        
> 
>     def install_package(self, programs=[]):
> -        print "installing external package"
> +        print("installing external package")
>         if not programs:
> -            programs = ['pythia-pgs','Delphes','ExRootAnalysis','MadAnalysis4','SysCalc']
> +            programs = ['pythia8','Delphes','ExRootAnalysis','MadAnalysis5']
> 
>         for prog in programs:
>             self.cmd.exec_cmd('install %s' % prog)
> 
> === modified file 'bin/create_aloha_release.py'
> --- bin/create_aloha_release.py	2013-11-13 02:21:10 +0000
> +++ bin/create_aloha_release.py	2021-03-24 10:12:56 +0000
> @@ -31,7 +31,9 @@
> 6. tar the ALOHA_vVERSION directory.
> """
> 
> +from __future__ import absolute_import
> import sys
> +from six.moves import input
> 
> if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
>     sys.exit('MadGraph5_aMC@NLO works only with python 2.6 or later (but not python 3.X).\n\
> @@ -79,19 +81,19 @@
> 
> if diff_result:
>     logging.warning("Directory is not up-to-date. The release follow the last commited version.")
> -    answer = raw_input('Do you want to continue anyway? (y/n)')
> +    answer = input('Do you want to continue anyway? (y/n)')
>     if answer != 'y':
>         exit()
> 
> release_date = date.fromtimestamp(time.time())
> -for line in file(os.path.join(MG5DIR,'VERSION')):
> +for line in open(os.path.join(MG5DIR,'VERSION')):
>     if 'version' in line:
>         logging.info(line)
>     if 'date' in line:
>         if not str(release_date.year) in line or not str(release_date.month) in line or \
>                                                            not str(release_date.day) in line:
>             logging.warning("WARNING: The release time information is : %s" % line)
> -            answer = raw_input('Do you want to continue anyway? (y/n)')
> +            answer = input('Do you want to continue anyway? (y/n)')
>             if answer != 'y':
>                 exit()
> 
> 
> === modified file 'bin/create_release.py'
> --- bin/create_release.py	2018-05-01 13:36:54 +0000
> +++ bin/create_release.py	2021-03-24 10:12:56 +0000
> @@ -29,10 +29,14 @@
> 6. tar the MadGraph5_vVERSION directory.
> """
> 
> +from __future__ import absolute_import
> +from __future__ import print_function
> import sys
> +from six.moves import range
> +from six.moves import input
> 
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadGraph5_aMC@NLO works only with python 2.6 or later (but not python 3.X).\n\
> +if sys.version_info[1] < 7:
> +    sys.exit('MadGraph5_aMC@NLO works only with python 2.7/3.7 or later.\n\
>                Please upgrate your version of python.')
> 
> import glob
> @@ -46,7 +50,7 @@
> import re
> import shutil
> import subprocess
> -import urllib
> +import six.moves.urllib.request, six.moves.urllib.parse, six.moves.urllib.error
> 
> from datetime import date
> 
> @@ -78,12 +82,12 @@
> 
> if diff_result:
>     logging.warning("Directory is not up-to-date. The release follow the last committed version.")
> -    answer = raw_input('Do you want to continue anyway? (y/n)')
> +    answer = input('Do you want to continue anyway? (y/n)')
>     if answer != 'y':
>         exit()
> 
> release_date = date.fromtimestamp(time.time())
> -for line in file(os.path.join(MG5DIR,'VERSION')):
> +for line in open(os.path.join(MG5DIR,'VERSION')):
>     if 'version' in line:
>         logging.info(line)
>         version = line.rsplit('=')[1].strip()
> @@ -91,14 +95,14 @@
>         if not str(release_date.year) in line or not str(release_date.month) in line or \
>                                                            not str(release_date.day) in line:
>             logging.warning("WARNING: The release time information is : %s" % line)
> -            answer = raw_input('Do you want to continue anyway? (y/n)')
> +            answer = input('Do you want to continue anyway? (y/n)')
>             if answer != 'y':
>                 exit()
> 
> -Update_note = file(os.path.join(MG5DIR,'UpdateNotes.txt')).read()
> +Update_note = open(os.path.join(MG5DIR,'UpdateNotes.txt')).read()
> if version not in Update_note:
>     logging.warning("WARNING: version number %s is not found in \'UpdateNotes.txt\'" % version)
> -    answer = raw_input('Do you want to continue anyway? (y/n)')
> +    answer = input('Do you want to continue anyway? (y/n)')
>     if answer != 'y':
>         exit()
> 
> @@ -114,7 +118,7 @@
> else:
>     logging.warning("WARNING: version number %s is not in format A.B.C,\n" % version +\
>          "in consequence the automatic update of the code will be deactivated" )
> -    answer = raw_input('Do you want to continue anyway? (y/n)')
> +    answer = input('Do you want to continue anyway? (y/n)')
>     if answer != 'y':
>         exit()
>     rev_nb=None
> @@ -123,11 +127,13 @@
> if rev_nb:
>     rev_nb_i = int(rev_nb)
>     try:
> -        filetext = urllib.urlopen('http://madgraph.phys.ucl.ac.be/mg5amc_build_nb')
> -        web_version = int(filetext.read().strip())            
> +        filetext = six.moves.urllib.request.urlopen('http://madgraph.physics.illinois.edu/mg5amc_build_nb')
> +        text = filetext.read().decode().split('\n')
> +        web_version = int(text[0].strip())
> +        last_message = int(text[1].strip())
>     except (ValueError, IOError):
>         logging.warning("WARNING: impossible to detect the version number on the web")
> -        answer = raw_input('Do you want to continue anyway? (y/n)')
> +        answer = input('Do you want to continue anyway? (y/n)')
>         if answer != 'y':
>             exit()
>         web_version = -1
> @@ -138,21 +144,21 @@
>     elif rev_nb_i in [web_version+i for i in range(1,4)]:
>         logging.warning("WARNING: current version on the web is %s" % web_version)
>         logging.warning("Please check that this (small difference) is expected.")
> -        answer = raw_input('Do you want to continue anyway? (y/n)')
> +        answer = input('Do you want to continue anyway? (y/n)')
>         if answer != 'y':
>             exit()
>     elif web_version < rev_nb_i:
>         logging.warning("CRITICAL: current version on the web is %s" % web_version)
>         logging.warning("This is a very large difference. Indicating a wrong manipulation.")
>         logging.warning("and can creates trouble for the auto-update.")
> -        answer = raw_input('Do you want to continue anyway? (y/n)')
> +        answer = input('Do you want to continue anyway? (y/n)')
>         if answer != 'y':
>             exit()
>     else:
>         logging.warning("CRITICAL: current version on the web is %s" % web_version)
>         logging.warning("This FORBIDS any auto-update for this version.")
>         rev_nb=None
> -        answer = raw_input('Do you want to continue anyway? (y/n)')
> +        answer = input('Do you want to continue anyway? (y/n)')
>         if answer != 'y':
>             exit()                        
> # 1. bzr branch the present directory to a new directory
> @@ -190,6 +196,7 @@
>     fsock = open(os.path.join(filepath,'input','.autoupdate'),'w')
>     fsock.write("version_nb   %s\n" % rev_nb)
>     fsock.write("last_check   %s\n" % int(time.time()))
> +    fsock.write("last_message %s\n" % int(last_message))
>     fsock.close()
> 
> # 1. Copy the .mg5_configuration_default.txt to it's default path
> @@ -254,7 +261,7 @@
> misc.wget(ninja_link, os.path.join(filepath, 'vendor', 'SMWidth.tar.gz')) 
> 
> if not os.path.exists(os.path.join(filepath, 'vendor', 'OfflineHEPToolsInstaller.tar.gz')):
> -    print 'Fail to create OfflineHEPToolsInstaller'
> +    print('Fail to create OfflineHEPToolsInstaller')
>     sys.exit()
> 
> # 5. tar the MadGraph5_vVERSION directory.
> @@ -281,14 +288,14 @@
> 
> 
> logging.info("Running tests on directory %s", filepath)
> -print os.listdir(filepath)
> +print(os.listdir(filepath))
> import subprocess
> status = subprocess.call([pjoin('tests', 'test_manager.py'),'-t0'],cwd=filepath)
> -print "status:", status
> +print("status:", status)
> status = subprocess.call([pjoin('tests', 'test_manager.py'),'-t0', '-pA'],cwd=filepath)
> -print "status:", status
> +print("status:", status)
> status = subprocess.call([pjoin('tests', 'test_manager.py'),'-t0','-pP' ,'test_short.*'],cwd=filepath)
> -print "status:", status
> +print("status:", status)
> 
> 
> logging.info("Thanks for creating a release. please check that the tests were sucessfull before releasing the version")
> 
> === modified file 'bin/mg5_aMC'
> --- bin/mg5_aMC	2020-06-08 15:08:17 +0000
> +++ bin/mg5_aMC	2021-03-24 10:12:56 +0000
> @@ -1,4 +1,6 @@
> -#! /usr/bin/env python
> +#! /usr/bin/env python3
> +from __future__ import absolute_import
> +from __future__ import print_function
> import time
> start = time.time()
> 
> @@ -20,9 +22,22 @@
> and call immediately the command line interface scripts"""
> 
> import sys
> -if not sys.version_info[0] == 2 or sys.version_info[1] < 6:
> -    sys.exit('MadGraph5_aMC@NLO works only with python 2.6 or later (but not python 3.X).\n\
> -               Please upgrate your version of python.')
> +if  sys.version_info[1] < 7:
> +    if sys.version_info[0] == 2:
> +        sys.exit("MadGraph5_aMC@NLO works only with python 2.7 or python 3.7 (and later).\n"+\
> +              "  You are currently using Python2.%s. Please use a more recent version of Python." % sys.version_info[1])
> +    if sys.version_info[0] == 3:
> +        sys.exit("MadGraph5_aMC@NLO works only with python 2.7 or python 3.7 (and later).\n"+\
> +              "  You are currently using Python 3.%i. So please upgrade your version of Python." % sys.version_info[1] +\
> +              "  If you have python2.7 installed you need to run the code as\n"+\
> +              "      python27 ./bin/mg5_aMC \n")
> +
> +try:
> +    import six
> +except ImportError:
> +    message = 'madgraph requires the six module. The easiest way to install it is to run "pip%s install six --user"\n' % (sys.version_info[0] if sys.version_info[0]==3 else '')
> +    message += 'in case of problem with pip, you can download the file at https://pypi.org/project/six/ . It has a single python file that you just need to put inside a directory of your $PYTHONPATH environment variable.'
> +    sys.exit(message)
> 
> import os
> import optparse
> @@ -67,8 +82,12 @@
> import logging.config
> import madgraph.interface.coloring_logging
> 
> +if sys.version_info[0] ==2:
> +    logging.warning("\033[91mpython2 support will be removed in last quarter 2021. If you use python2 due to issue with Python3, please report them on https://bugs.launchpad.net/mg5amcnlo\033[0m")
> +
> +
> if ' ' in os.getcwd():
> -    logging.warning("Path does contains spaces. We advise that you change your current path to avoid to have space in the path.")
> +    logging.warning("\033[91mPath does contains spaces. We advise that you change your current path to avoid to have space in the path.\033[0m")
> 
> try: 
>     import readline
> @@ -129,7 +148,7 @@
> import madgraph.interface.master_interface as interface
> 
> if __debug__ and time.time() - start > 0.5:
> -    print( 'WARNING: loading of madgraph too slow!!!', time.time() - start)
> +    print(( 'WARNING: loading of madgraph too slow!!!', time.time() - start))
> 
> try:
>     import madgraph.various.misc as misc
> @@ -184,7 +203,7 @@
>     else:
>         # Interactive mode
>         if options.web:
> -            if not os.environ.has_key('MADGRAPH_DATA'):
> +            if 'MADGRAPH_DATA' not in os.environ:
>                 os.environ['MADGRAPH_DATA'] = root_path
>                 os.environ['MADGRAPH_BASE'] = os.path.join(root_path,'input')
>                 os.environ['REMOTE_USER'] = 'webmode'
> @@ -192,7 +211,7 @@
>         else:
>             cmd_line.cmdloop()
> except KeyboardInterrupt:
> -    print 'writting history and quit on KeyboardInterrupt' 
> +    print('writting history and quit on KeyboardInterrupt') 
>     pass
> 
> try:
> @@ -201,7 +220,7 @@
>     if not os.path.exists(os.path.join(os.environ['HOME'], '.mg5')):
>         os.mkdir(os.path.join(os.environ['HOME'], '.mg5'))
>     readline.write_history_file(history_file)
> -except Exception, error:
> +except Exception as error:
>     pass
> 
> 
> 
> === modified file 'input/.mg5_configuration_default.txt'
> --- input/.mg5_configuration_default.txt	2016-10-21 11:52:56 +0000
> +++ input/.mg5_configuration_default.txt	2021-03-24 10:12:56 +0000
> @@ -29,7 +29,8 @@
> #! If None: try to find g77 or gfortran on the system
> #!
> # fortran_compiler = None
> -# f2py_compiler = None 
> +# f2py_compiler_py2 = None
> +# f2py_compiler_py3 = None 
> 
> 
> #! Prefered C++ Compiler
> @@ -159,9 +160,10 @@
> #!  relative path start from main directory
> # td_path = ./td
> 
> -#! lhapdf-config
> +#! lhapdf-config --can be specify differently depending of your python version
> #!  If None: try to find one available on the system
> -# lhapdf = lhapdf-config
> +# lhapdf_py2 = lhapdf-config
> +# lhapdf_py3 = lhapdf-config
> 
> #! fastjet-config
> #!  If None: try to find one available on the system
> @@ -216,8 +218,8 @@
> #! relative path start from main directory
> # syscalc_path = ./SysCalc
> 
> -#! Absolute paths to config scripts in the bin directories for APPLgrid and aMCFast.
> -# applgrid = applgrid-config
> -# amcfast = amcfast-config
> +#! Absolute paths to the config script in the bin directory of PineAPPL
> +#! (to generate PDF-independent fast-interpolation grids).
> +# pineappl = pineappl
> 
> 
> 
> === modified file 'madgraph/__init__.py'
> --- madgraph/__init__.py	2019-12-20 22:54:18 +0000
> +++ madgraph/__init__.py	2021-03-24 10:12:56 +0000
> @@ -12,6 +12,7 @@
> # For more information, visit madgraph.phys.ucl.ac.be and amcatnlo.web.cern.ch
> #
> ################################################################################
> +from __future__ import absolute_import
> class MadGraph5Error(Exception):
>     """Exception raised if an exception is find 
>     Those Types of error will stop nicely in the cmd interface"""
> @@ -46,7 +47,7 @@
>             os.remove(tmp_path)
>             shutil.copy(pjoin(MG5DIR, 'Template','LO','Source','.make_opts'),
>                     pjoin(MG5DIR, 'Template','LO','Source','make_opts'))
> -    except Exception,error:
> +    except Exception as error:
>         pass
> 
> ADMIN_DEBUG = False  
> 
> === modified file 'madgraph/core/base_objects.py'
> --- madgraph/core/base_objects.py	2020-06-30 12:23:40 +0000
> +++ madgraph/core/base_objects.py	2021-03-24 10:12:56 +0000
> @@ -15,6 +15,7 @@
> """Definitions of all basic objects used in the core code: particle, 
> interaction, model, leg, vertex, process, ..."""
> 
> +from __future__ import absolute_import
> import copy
> import itertools
> import logging
> @@ -22,11 +23,15 @@
> import numbers
> import os
> import re
> -import StringIO
> +import six
> +StringIO = six
> import madgraph.core.color_algebra as color
> import collections
> from madgraph import MadGraph5Error, MG5DIR, InvalidCmd
> import madgraph.various.misc as misc 
> +from six.moves import range
> +from six.moves import zip
> +from functools import reduce
> 
> 
> logger = logging.getLogger('madgraph.base_objects')
> @@ -81,10 +86,9 @@
>         assert isinstance(name, str), \
>                                  "Property name %s is not a string" % repr(name)
> 
> -        if name not in self.keys():
> -            raise self.PhysicsObjectError, \
> -                        """%s is not a valid property for this object: %s\n
> -    Valid property are %s""" % (name,self.__class__.__name__, self.keys())
> +        if name not in list(self.keys()):
> +            raise self.PhysicsObjectError("""%s is not a valid property for this object: %s\n
> +    Valid property are %s""" % (name,self.__class__.__name__, list(self.keys())))
>         return True
> 
>     def get(self, name):
> @@ -105,7 +109,7 @@
>                 self.filter(name, value)
>                 self[name] = value
>                 return True
> -            except self.PhysicsObjectError, why:
> +            except self.PhysicsObjectError as why:
>                 logger.warning("Property " + name + " cannot be changed:" + \
>                                 str(why))
>                 return False
> @@ -120,7 +124,7 @@
>         """Returns the object keys sorted in a certain way. By default,
>         alphabetical."""
> 
> -        return self.keys().sort()
> +        return list(self.keys()).sort()
> 
>     def __str__(self):
>         """String representation of the object. Outputs valid Python 
> @@ -273,100 +277,77 @@
>             # Forbid special character but +-~_
>             p=re.compile('''^[\w\-\+~_]+$''')
>             if not p.match(value):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid particle name" % value
> +                raise self.PhysicsObjectError("%s is not a valid particle name" % value)
> 
> -        if name is 'ghost':
> +        if name == 'ghost':
>             if not isinstance(value,bool):
> -                raise self.PhysicsObjectError, \
> -                 "%s is not a valid bool for the 'ghost' attribute" % str(value)
> -                 
> -        if name is 'counterterm':
> +                raise self.PhysicsObjectError("%s is not a valid bool for the 'ghost' attribute" % str(value))
> +    
> +        if name == 'counterterm':
>             if not isinstance(value,dict):
> -                raise self.PhysicsObjectError, \
> -                    "counterterm %s is not a valid dictionary" % repr(value)
> +                raise self.PhysicsObjectError("counterterm %s is not a valid dictionary" % repr(value))
>             for key, val in value.items():
>                 if not isinstance(key,tuple):
> -                    raise self.PhysicsObjectError, \
> -                        "key %s is not a valid tuple for counterterm key" % repr(key)
> +                    raise self.PhysicsObjectError("key %s is not a valid tuple for counterterm key" % repr(key))
>                 if not isinstance(key[0],str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % repr(key[0])
> +                    raise self.PhysicsObjectError("%s is not a valid string" % repr(key[0]))
>                 if not isinstance(key[1],tuple):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % repr(key[1])
> +                    raise self.PhysicsObjectError("%s is not a valid list" % repr(key[1]))
>                 for elem in key[1]:
>                     if not isinstance(elem,tuple):
> -                        raise self.PhysicsObjectError, \
> -                            "%s is not a valid list" % repr(elem)
> +                        raise self.PhysicsObjectError("%s is not a valid list" % repr(elem))
>                     for partPDG in elem:
>                         if not isinstance(partPDG,int):
> -                            raise self.PhysicsObjectError, \
> -                                "%s is not a valid integer for PDG" % repr(partPDG)
> +                            raise self.PhysicsObjectError("%s is not a valid integer for PDG" % repr(partPDG))
>                         if partPDG<=0:
> -                            raise self.PhysicsObjectError, \
> -                                "%s is not a valid positive PDG" % repr(partPDG)
> +                            raise self.PhysicsObjectError("%s is not a valid positive PDG" % repr(partPDG))
>                 if not isinstance(val,dict):
> -                    raise self.PhysicsObjectError, \
> -                        "value %s is not a valid dictionary for counterterm value" % repr(val)
> +                    raise self.PhysicsObjectError("value %s is not a valid dictionary for counterterm value" % repr(val))
>                 for vkey, vvalue in val.items():
>                     if vkey not in [0,-1,-2]:
> -                        raise self.PhysicsObjectError, \
> -                            "Key %s is not a valid laurent serie order" % repr(vkey)
> +                        raise self.PhysicsObjectError("Key %s is not a valid laurent serie order" % repr(vkey))
>                     if not isinstance(vvalue,str):
> -                        raise self.PhysicsObjectError, \
> -                            "Coupling %s is not a valid string" % repr(vvalue)
> -        if name is 'spin':
> +                        raise self.PhysicsObjectError("Coupling %s is not a valid string" % repr(vvalue))
> +        if name == 'spin':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                    "Spin %s is not an integer" % repr(value)
> +                raise self.PhysicsObjectError("Spin %s is not an integer" % repr(value))
>             if (value < 1 or value > 5) and value != 99:
> -                raise self.PhysicsObjectError, \
> -                   "Spin %i not valid" % value
> +                raise self.PhysicsObjectError("Spin %i not valid" % value)
> 
> -        if name is 'color':
> +        if name == 'color':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                    "Color %s is not an integer" % repr(value)
> +                raise self.PhysicsObjectError("Color %s is not an integer" % repr(value))
>             if value not in [1, 3, 6, 8]:
> -                raise self.PhysicsObjectError, \
> -                   "Color %i is not valid" % value
> +                raise self.PhysicsObjectError("Color %i is not valid" % value)
> 
>         if name in ['mass', 'width']:
>             # Must start with a letter, followed by letters, digits or _
>             p = re.compile('\A[a-zA-Z]+[\w\_]*\Z')
>             if not p.match(value):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid name for mass/width variable" % \
> -                        value
> +                raise self.PhysicsObjectError("%s is not a valid name for mass/width variable" % \
> +                        value)
> 
> -        if name is 'pdg_code':
> +        if name == 'pdg_code':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                    "PDG code %s is not an integer" % repr(value)
> +                raise self.PhysicsObjectError("PDG code %s is not an integer" % repr(value))
> 
> -        if name is 'line':
> +        if name == 'line':
>             if not isinstance(value, str):
> -                raise self.PhysicsObjectError, \
> -                    "Line type %s is not a string" % repr(value)
> +                raise self.PhysicsObjectError("Line type %s is not a string" % repr(value))
>             if value not in ['None','dashed', 'straight', 'wavy', 'curly', 'double','swavy','scurly','dotted']:
> -                raise self.PhysicsObjectError, \
> -                   "Line type %s is unknown" % value
> +                raise self.PhysicsObjectError("Line type %s is unknown" % value)
> 
> -        if name is 'charge':
> +        if name == 'charge':
>             if not isinstance(value, float):
> -                raise self.PhysicsObjectError, \
> -                    "Charge %s is not a float" % repr(value)
> +                raise self.PhysicsObjectError("Charge %s is not a float" % repr(value))
> 
> -        if name is 'propagating':
> +        if name == 'propagating':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                    "Propagating tag %s is not a boolean" % repr(value)
> +                raise self.PhysicsObjectError("Propagating tag %s is not a boolean" % repr(value))
> 
>         if name in ['is_part', 'self_antipart']:
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                    "%s tag %s is not a boolean" % (name, repr(value))
> +                raise self.PhysicsObjectError("%s tag %s is not a boolean" % (name, repr(value)))
> 
>         return True
> 
> @@ -392,7 +373,7 @@
>             # type "QCD".
>             if len(int.get('orders'))>1:
>                 continue
> -            if order in int.get('orders').keys() and self.get('pdg_code') in \
> +            if order in list(int.get('orders').keys()) and self.get('pdg_code') in \
>               [part.get('pdg_code') for part in int.get('particles')]:
>                 return True
> 
> @@ -487,8 +468,7 @@
>             # Massive tensor
>             res = [-2, -1, 0, 1, 2]
>         else:
> -            raise self.PhysicsObjectError, \
> -              "No helicity state assignment for spin %d particles" % spin
> +            raise self.PhysicsObjectError("No helicity state assignment for spin %d particles" % spin)
> 
>         if allow_reverse and not self.get('is_part'):
>             res.reverse()
> @@ -690,91 +670,73 @@
>         if name == 'id':
>             #Should be an integer
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer" % str(value))
> 
>         if name == 'particles':
>             #Should be a list of valid particle names
>             if not isinstance(value, ParticleList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of particles" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of particles" % str(value))
> 
>         if name == 'perturbation_type':
>             if value!=None and not isinstance(value, str):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(value)            
> +                raise self.PhysicsObjectError("%s is not a valid string" % str(value))            
> 
>         if name == 'type':
>             #Should be a string
>             if not isinstance(value, str):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid string" % str(value))
>         if name == 'loop_particles':
>             if isinstance(value,list):
>                 for l in value:
>                     if isinstance(l,list):
>                         for part in l:
>                             if not isinstance(part,int):
> -                                raise self.PhysicsObjectError, \
> -                                    "%s is not a valid integer" % str(part)
> +                                raise self.PhysicsObjectError("%s is not a valid integer" % str(part))
>                             if part<0:
> -                                raise self.PhysicsObjectError, \
> -                                    "%s is not a valid positive integer" % str(part)
> +                                raise self.PhysicsObjectError("%s is not a valid positive integer" % str(part))
> 
>         if name == 'orders':
>             #Should be a dict with valid order names ask keys and int as values
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dict for coupling orders" % \
> -                                                                    str(value)
> +                raise self.PhysicsObjectError("%s is not a valid dict for coupling orders" % \
> +                                                                    str(value))
>             for order in value.keys():
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(order)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(order))
>                 if not isinstance(value[order], int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value[order])
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(value[order]))
> 
>         if name in ['color']:
>             #Should be a list of list strings
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of Color Strings" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of Color Strings" % str(value))
>             for mycolstring in value:
>                 if not isinstance(mycolstring, color.ColorString):
> -                    raise self.PhysicsObjectError, \
> -                            "%s is not a valid list of Color Strings" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of Color Strings" % str(value))
> 
>         if name in ['lorentz']:
>             #Should be a list of list strings
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of strings" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of strings" % str(value))
>             for mystr in value:
>                 if not isinstance(mystr, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(mystr)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(mystr))
> 
>         if name == 'couplings':
>             #Should be a dictionary of strings with (i,j) keys
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dictionary for couplings" % \
> -                                                                str(value)
> +                raise self.PhysicsObjectError("%s is not a valid dictionary for couplings" % \
> +                                                                str(value))
> 
>             for key in value.keys():
>                 if not isinstance(key, tuple):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid tuple" % str(key)
> +                    raise self.PhysicsObjectError("%s is not a valid tuple" % str(key))
>                 if len(key) != 2:
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid tuple with 2 elements" % str(key)
> +                    raise self.PhysicsObjectError("%s is not a valid tuple with 2 elements" % str(key))
>                 if not isinstance(key[0], int) or not isinstance(key[1], int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid tuple of integer" % str(key)
> +                    raise self.PhysicsObjectError("%s is not a valid tuple of integer" % str(key))
>                 if not isinstance(value[key], str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % value[key]
> +                    raise self.PhysicsObjectError("%s is not a valid string" % value[key])
> 
>         return True
> 
> @@ -797,7 +759,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             return (len(self['type'])>=2 and self['type'][:2]=='R2')
>         else:
>             return False
> @@ -807,7 +769,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             return (len(self['type'])>=2 and self['type'][:2]=='UV')
>         else:
>             return False
> @@ -817,7 +779,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             return (len(self['type'])>=6 and self['type'][:6]=='UVmass')
>         else:
>             return False
> @@ -827,7 +789,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             return (len(self['type'])>=6 and self['type'][:6]=='UVloop')
>         else:
>             return False
> @@ -837,7 +799,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             return (len(self['type'])>=6 and self['type'][:6]=='UVtree')
>         else:
>             return False
> @@ -850,7 +812,7 @@
> 
>         # Precaution only useful because some tests have a predefined model
>         # bypassing the default_setup and for which type was not defined.
> -        if 'UVCT_SPECIAL' in self['orders'].keys():
> +        if 'UVCT_SPECIAL' in list(self['orders'].keys()):
>             return True
>         else:
>             return False
> @@ -859,7 +821,7 @@
>         """ Returns 0 if this interaction contributes to the finite part of the
>         amplitude and 1 (2) is it contributes to its single (double) pole """
> 
> -        if 'type' in self.keys():
> +        if 'type' in list(self.keys()):
>             if '1eps' in self['type']:
>                 return 1
>             elif '2eps' in self['type']:
> @@ -877,7 +839,7 @@
>         # We are interested in the unordered list, so use sorted()
> 
>         pdg_tuple = tuple(sorted([p.get_pdg_code() for p in self['particles']]))
> -        if pdg_tuple not in ref_dict_to0.keys():
> +        if pdg_tuple not in list(ref_dict_to0.keys()):
>             ref_dict_to0[pdg_tuple] = [self['id']]
>         else:
>             ref_dict_to0[pdg_tuple].append(self['id'])
> @@ -895,7 +857,7 @@
>                                       enumerate(self['particles']) if \
>                                       i != self['particles'].index(part)]))
>             pdg_part = part.get_anti_pdg_code()
> -            if pdg_tuple in ref_dict_to1.keys():
> +            if pdg_tuple in list(ref_dict_to1.keys()):
>                 if (pdg_part, self['id']) not in  ref_dict_to1[pdg_tuple]:
>                     ref_dict_to1[pdg_tuple].append((pdg_part, self['id']))
>             else:
> @@ -949,7 +911,7 @@
>         flavors with identical masses and couplings) can be matched even though
>         the order of the couplings specified in the UFO is different. """
> 
> -        return sorted(self['couplings'].keys(), key=lambda k:
> +        return sorted(list(self['couplings'].keys()), key=lambda k:
>         '%s_%s_%s'%(self['color'][k[0]],self['lorentz'][k[1]],self['couplings'][k]))
> 
> 
> @@ -1091,73 +1053,59 @@
> 
>         if name in ['name']:
>             if not isinstance(value, str):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a string" %type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a string" %type(value))
> 
>         elif name == 'particles':
>             if not isinstance(value, ParticleList):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a ParticleList object" % \
> -                                                            type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a ParticleList object" % \
> +                                                            type(value))
>         elif name == 'interactions':
>             if not isinstance(value, InteractionList):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a InteractionList object" % \
> -                                                            type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a InteractionList object" % \
> +                                                            type(value))
>         elif name == 'particle_dict':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a dictionary" % \
> -                                                        type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a dictionary" % \
> +                                                        type(value))
>         elif name == 'interaction_dict':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a dictionary" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a dictionary" % type(value))
> 
>         elif name == 'ref_dict_to0':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a dictionary" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a dictionary" % type(value))
> 
>         elif name == 'ref_dict_to1':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a dictionary" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a dictionary" % type(value))
> 
>         elif name == 'got_majoranas':
>             if not (isinstance(value, bool) or value == None):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a boolean" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a boolean" % type(value))
> 
>         elif name == 'conserved_charge':
>             if not (isinstance(value, set)):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a set" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a set" % type(value))
> 
>         elif name == 'version_tag':
>             if not (isinstance(value, str)):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a string" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a string" % type(value))
> 
>         elif name == 'order_hierarchy':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a dictionary" % \
> -                                                            type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a dictionary" % \
> +                                                            type(value))
>             for key in value.keys():
>                 if not isinstance(value[key],int):
> -                    raise self.PhysicsObjectError, \
> -                        "Object of type %s is not an integer" % \
> -                                                            type(value[key])
> +                    raise self.PhysicsObjectError("Object of type %s is not an integer" % \
> +                                                            type(value[key]))
>         elif name == 'gauge':
>             if not (isinstance(value, list)):
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a list" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a list" % type(value))
> 
>         elif name == 'case_sensitive':
>             if not value in [True ,False]:
> -                raise self.PhysicsObjectError, \
> -                    "Object of type %s is not a boolean" % type(value)
> +                raise self.PhysicsObjectError("Object of type %s is not a boolean" % type(value))
> 
> 
>         return True
> @@ -1185,7 +1133,7 @@
>                 modeldir = os.path.expanduser(modeldir)
>                 return modeldir
>             else:
> -                raise Exception, "path %s not valid anymore." % modeldir
> +                raise Exception("path %s not valid anymore." % modeldir)
>             #modeldir = os.path.join(os.path.dirname(modeldir),
>             #                        os.path.basename(modeldir).rsplit("-",1)[0])
>             #if os.path.exists(modeldir):
> @@ -1195,7 +1143,7 @@
>             modeldir = self.get('version_tag').rsplit('##',1)[0]
>             modelname = self['name']            
>             if not  os.path.exists(modeldir):
> -                raise Exception, "path %s not valid anymore" % modeldir
> +                raise Exception("path %s not valid anymore" % modeldir)
>             modeldir = os.path.dirname(modeldir)
>             modeldir = pjoin(modeldir, modelname)
>             modeldir = os.path.expanduser(modeldir)
> @@ -1295,7 +1243,7 @@
>             if isinstance(id, int):
>                 try:
>                     return self.get("particle_dict")[id]
> -                except Exception, error:
> +                except Exception as error:
>                     return None
>             else:
>                 if not hasattr(self, 'name2part'):
> @@ -1359,7 +1307,7 @@
> 
>     def get_coupling_orders(self):
>         """Determine the coupling orders of the model"""
> -        return set(sum([i.get('orders').keys() for i in \
> +        return set(sum([list(i.get('orders').keys()) for i in \
>                         self.get('interactions')], []))
> 
>     def get_order_hierarchy(self):
> @@ -1525,8 +1473,8 @@
>                 'to use the particles name defined in the model and not the ' + \
>                 'MadGraph5_aMC@NLO convention'
> 
> -                raise MadGraph5Error, error_text % \
> -                                     (part.get_name(), part.get_pdg_code(), pdg)                
> +                raise MadGraph5Error(error_text % \
> +                                     (part.get_name(), part.get_pdg_code(), pdg))                
> 
>         default = self.load_default_name()
> 
> @@ -1563,7 +1511,7 @@
> 
>         lower_dict={}
>         duplicate = set()
> -        keys = self.get('parameters').keys()
> +        keys = list(self.get('parameters').keys())
>         for key in keys:
>             for param in self['parameters'][key]:
>                 lower_name = param.name.lower()
> @@ -1668,7 +1616,7 @@
>     def get_first_non_pdg(self):
>         """Return the first positive number that is not a valid PDG code"""
>         return [c for c in range(1, len(self.get('particles')) + 1) if \
> -                c not in self.get('particle_dict').keys()][0]
> +                c not in list(self.get('particle_dict').keys())][0]
> 
> 
>     def write_param_card(self, filepath=None):
> @@ -1920,7 +1868,7 @@
>         # So at this stage we still need to modify all parameters depending of
>         # particle's mass. In addition all parameter (but mass/width/external 
>         # parameter) should be pass in complex mode.
> -        pat = '|'.join(to_change.keys())
> +        pat = '|'.join(list(to_change.keys()))
>         pat = r'(%s)\b' % pat
>         pat = re.compile(pat)
>         def replace(match):
> @@ -2034,44 +1982,37 @@
> 
>         if name in ['id', 'number']:
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer for leg id" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer for leg id" % str(value))
> 
> -        if name == 'state':
> +        elif name == 'state':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid leg state (True|False)" % \
> -                                                                    str(value)
> -
> -        if name == 'from_group':
> -            if not isinstance(value, bool) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid boolean for leg flag from_group" % \
> -                                                                    str(value)
> -
> -        if name == 'loop_line':
> -            if not isinstance(value, bool) and value != None:
> -                raise self.PhysicsObjectError, \
> -                    "%s is not a valid boolean for leg flag loop_line" % \
> -                                                                    str(value)
> -
> -        if name == 'onshell':
> -            if not isinstance(value, bool) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid boolean for leg flag onshell" % \
> -                                                                    str(value)
> -                                                                    
> +                raise self.PhysicsObjectError("%s is not a valid leg state (True|False)" % \
> +                                                                    str(value))
> +
> +        elif name == 'from_group':
> +            if not isinstance(value, bool) and value != None:
> +                raise self.PhysicsObjectError("%s is not a valid boolean for leg flag from_group" % \
> +                                                                    str(value))
> +
> +        elif name == 'loop_line':
> +            if not isinstance(value, bool) and value != None:
> +                raise self.PhysicsObjectError("%s is not a valid boolean for leg flag loop_line" % \
> +                                                                    str(value))
> +
> +        elif name == 'onshell':
> +            if not isinstance(value, bool) and value != None:
> +                raise self.PhysicsObjectError("%s is not a valid boolean for leg flag onshell" % \
> +                                                                    str(value))
> 
> -        if name == 'polarization':
> +        elif name == 'polarization':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError( \
> +                        "%s is not a valid list" % str(value))
>             for i in value:
>                 if i not in [-1, 1, 2,-2, 3,-3, 0, 99]:
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid polarization" % str(value)
> +                    raise self.PhysicsObjectError( \
> +                          "%s is not a valid polarization" % str(value))
> 
> -        
>         return True
> 
>     def get_sorted_keys(self):
> @@ -2157,7 +2098,7 @@
>     def from_group_elements(self):
>         """Return all elements which have 'from_group' True"""
> 
> -        return filter(lambda leg: leg.get('from_group'), self)
> +        return [leg for leg in self if leg.get('from_group')]
> 
>     def minimum_one_from_group(self):
>         """Return True if at least one element has 'from_group' True"""
> @@ -2173,7 +2114,7 @@
>         """If has at least one 'from_group' True and in ref_dict_to1,
>            return the return list from ref_dict_to1, otherwise return False"""
>         if self.minimum_one_from_group():
> -            return ref_dict_to1.has_key(tuple(sorted([leg.get('id') for leg in self])))
> +            return tuple(sorted([leg.get('id') for leg in self])) in ref_dict_to1
>         else:
>             return False
> 
> @@ -2192,11 +2133,11 @@
>             # unclustered, since we want this to stay until the very
>             # end.
>             return any(leg.get('from_group') == None for leg in self) and \
> -                   ref_dict_to0.has_key(tuple(sorted([leg.get('id') \
> -                                                      for leg in self])))
> +                   tuple(sorted([leg.get('id') \
> +                                                      for leg in self])) in ref_dict_to0
> 
>         if self.minimum_two_from_group():
> -            return ref_dict_to0.has_key(tuple(sorted([leg.get('id') for leg in self])))
> +            return tuple(sorted([leg.get('id') for leg in self])) in ref_dict_to0
>         else:
>             return False
> 
> @@ -2220,7 +2161,7 @@
>     def sort(self,*args, **opts):
>         """Match with FKSLegList"""
>         Opts=copy.copy(opts)
> -        if 'pert' in Opts.keys():
> +        if 'pert' in list(Opts.keys()):
>             del Opts['pert']
>         return super(LegList,self).sort(*args, **Opts)
> 
> @@ -2244,27 +2185,24 @@
> 
>         if name == 'ids':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for i in value:
>                 if not isinstance(i, int):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid list of integers" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
> 
>         if name == 'polarization':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError( \
> +                        "%s is not a valid list" % str(value))
>             for i in value:
>                 if i not in [-1, 1,  2, -2, 3, -3, 0, 99]:
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid polarization" % str(value)
> +                    raise self.PhysicsObjectError( \
> +                          "%s is not a valid polarization" % str(value))
> 
>         if name == 'state':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid leg state (initial|final)" % \
> -                                                                    str(value)
> +                raise self.PhysicsObjectError("%s is not a valid leg state (initial|final)" % \
> +                                                                    str(value))
> 
>         return True
> 
> @@ -2313,6 +2251,7 @@
>     # the list ID_to_veto_for_multichanneling then all loop are considered by 
>     # default and the constraint below is not applied.
>     max_n_loop_for_multichanneling = 4
> +    max_tpropa = 99
> 
>     def default_setup(self):
>         """Default values for all properties"""
> @@ -2332,13 +2271,11 @@
> 
>         if name == 'id':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer for vertex id" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer for vertex id" % str(value))
> 
>         if name == 'legs':
>             if not isinstance(value, LegList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid LegList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid LegList object" % str(value))
> 
>         return True
> 
> @@ -2455,20 +2392,16 @@
>             if isinstance(value, list):
>                 for elem in value:
>                     if not isinstance(elem,int):
> -                        raise self.PhysicsObjectError, \
> -                            "%s is not a valid integer for leg PDG" % str(elem)
> +                        raise self.PhysicsObjectError("%s is not a valid integer for leg PDG" % str(elem))
>             else:
> -                raise self.PhysicsObjectError, \
> -                  "%s is not a valid list for contracted vertex PDGs"%str(value)                
> +                raise self.PhysicsObjectError("%s is not a valid list for contracted vertex PDGs"%str(value))                
>         if name == 'loop_tag':
>             if isinstance(value, tuple):
>                 for elem in value:
>                     if not (isinstance(elem,int) or isinstance(elem,tuple)):
> -                        raise self.PhysicsObjectError, \
> -                          "%s is not a valid int or tuple for loop tag element"%str(elem)
> +                        raise self.PhysicsObjectError("%s is not a valid int or tuple for loop tag element"%str(elem))
>             else:
> -                raise self.PhysicsObjectError, \
> -                  "%s is not a valid tuple for a contracted vertex loop_tag."%str(value)
> +                raise self.PhysicsObjectError("%s is not a valid tuple for a contracted vertex loop_tag."%str(value))
>         if name == 'loop_orders':
>             Interaction.filter(Interaction(), 'orders', value)
>         else:
> @@ -2499,8 +2432,7 @@
> 
>         if name == 'vertices':
>             if not isinstance(value, VertexList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid VertexList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid VertexList object" % str(value))
> 
>         if name == 'orders':
>             Interaction.filter(Interaction(), 'orders', value)
> @@ -2547,7 +2479,7 @@
>                                      for key in sorted(self['orders'].keys())]))
> 
>             if not pass_sanity:
> -                raise Exception, "invalid diagram: %s. vert_id: %s" % (mystr, responsible) 
> +                raise Exception("invalid diagram: %s. vert_id: %s" % (mystr, responsible)) 
> 
>             return mystr
>         else:
> @@ -2657,6 +2589,20 @@
>         state_dict = {True:'T',False:'F'}
>         return new_diag
> 
> +    def get_nb_t_channel(self):
> +        """return number of t-channel propagator in this diagram 
> +           This is used to filter multi-channel.
> +        """
> +        nb_t = 0
> +        for v in self['vertices'][:-1]:
> +            l = v.get('legs')[-1]
> +            if not l.get('state'):
> +                nb_t +=1
> +        return nb_t
> +
> +            
> +            
> +
>     def get_vertex_leg_numbers(self, 
>                         veto_inter_id=Vertex.ID_to_veto_for_multichanneling,
>                         max_n_loop=0):
> @@ -2668,7 +2614,7 @@
> 
> 
>         if max_n_loop == 0:
> -            max_n_loop = Vertex.max_n_loop_for_multichanneling
> +            max_n_loop = int(Vertex.max_n_loop_for_multichanneling)
> 
>         res = [len(v.get('legs')) for v in self.get('vertices') if (v.get('id') \
>                                   not in veto_inter_id) or (v.get('id')==-2 and 
> @@ -2717,7 +2663,7 @@
>             security =0
>             while not vcurrent.is_external():
>                 if security > 1000:
> -                    raise Exception, 'wrong diagram'
> +                    raise Exception('wrong diagram')
>                 next_l = [l for l in vcurrent.lines if l is not l_last and l.is_fermion()][0]
>                 next_v = next_l.end
>                 if next_v == vcurrent:
> @@ -2758,7 +2704,7 @@
>         max_order=-1
> 
>         for diag in self:
> -            if order in diag['orders'].keys():
> +            if order in list(diag['orders'].keys()):
>                 if max_order==-1 or diag['orders'][order] > max_order:
>                     max_order = diag['orders'][order]
> 
> @@ -2819,7 +2765,7 @@
>         order for the coupling specified """
>         min_order=-1
>         for diag in self:
> -            if order in diag['orders'].keys():
> +            if order in list(diag['orders'].keys()):
>                 if min_order==-1 or diag['orders'][order] < min_order:
>                     min_order = diag['orders'][order]
>             else:
> @@ -2833,7 +2779,7 @@
> 
>         values=set([])
>         for diag in self:
> -            if order in diag['orders'].keys():
> +            if order in list(diag['orders'].keys()):
>                 values.add(diag['orders'][order])
>             else:
>                 values.add(0)  
> @@ -2896,7 +2842,7 @@
>         # keep track of the orders that have been explicitly asked by the 
>         # user, because other borns will appear used for the subtraction
>         # of singularities
> -        self['born_orders'] = {}
> +        self['born_sq_orders'] = {}
>         # The user might want to have the individual matrix element evaluations
>         # for specific values of the coupling orders. The list below specifies
>         # what are the coupling names which need be individually treated.
> @@ -2913,113 +2859,89 @@
> 
>         if name in ['legs', 'legs_with_decays'] :
>             if not isinstance(value, LegList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid LegList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid LegList object" % str(value))
> 
> -        if name in ['orders', 'overall_orders','squared_orders', 'born_orders']:
> +        if name in ['orders', 'overall_orders','squared_orders', 'born_sq_orders']:
>             Interaction.filter(Interaction(), 'orders', value)
> 
>         if name == 'constrained_orders':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dictionary" % str(value)            
> +                raise self.PhysicsObjectError("%s is not a valid dictionary" % str(value))            
> 
>         if name == 'sqorders_types':
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dictionary" % str(value)
> -            for order in value.keys()+value.values():
> +                raise self.PhysicsObjectError("%s is not a valid dictionary" % str(value))
> +            for order in list(value.keys())+list(value.values()):
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid string" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(value))
> 
>         if name == 'split_orders':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for order in value:
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid string" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(value))
> 
>         if name == 'model':
>             if not isinstance(value, Model):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid Model object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid Model object" % str(value))
>         if name in ['id', 'uid']:
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                    "Process %s %s is not an integer" % (name, repr(value))
> +                raise self.PhysicsObjectError("Process %s %s is not an integer" % (name, repr(value)))
> 
>         if name == 'required_s_channels':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for l in value:
>                 if not isinstance(l, list):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid list of lists" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of lists" % str(value))
>                 for i in l:
>                     if not isinstance(i, int):
> -                        raise self.PhysicsObjectError, \
> -                              "%s is not a valid list of integers" % str(l)
> +                        raise self.PhysicsObjectError("%s is not a valid list of integers" % str(l))
>                     if i == 0:
> -                        raise self.PhysicsObjectError, \
> -                          "Not valid PDG code %d for s-channel particle" % i
> +                        raise self.PhysicsObjectError("Not valid PDG code %d for s-channel particle" % i)
> 
>         if name in ['forbidden_onsh_s_channels', 'forbidden_s_channels']:
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for i in value:
>                 if not isinstance(i, int):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid list of integers" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
>                 if i == 0:
> -                    raise self.PhysicsObjectError, \
> -                      "Not valid PDG code %d for s-channel particle" % str(value)
> +                    raise self.PhysicsObjectError("Not valid PDG code %d for s-channel particle" % str(value))
> 
>         if name == 'forbidden_particles':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for i in value:
>                 if not isinstance(i, int):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid list of integers" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
>                 if i <= 0:
> -                    raise self.PhysicsObjectError, \
> -                      "Forbidden particles should have a positive PDG code" % str(value)
> +                    raise self.PhysicsObjectError("Forbidden particles should have a positive PDG code" % str(value))
> 
>         if name == 'perturbation_couplings':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
>             for order in value:
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                          "%s is not a valid string" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(value))
> 
>         if name == 'is_decay_chain':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid bool" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid bool" % str(value))
> 
>         if name == 'has_born':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid bool" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid bool" % str(value))
> 
>         if name == 'decay_chains':
>             if not isinstance(value, ProcessList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ProcessList" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ProcessList" % str(value))
> 
>         if name == 'NLO_mode':
>             import madgraph.interface.madgraph_interface as mg
>             if value not in mg.MadGraphCmd._valid_nlo_modes:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid NLO_mode" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid NLO_mode" % str(value))
>         return True
> 
>     def has_multiparticle_label(self):
> @@ -3049,7 +2971,7 @@
>         """ Return what kind of squared order constraint was specified for the
>         order 'order'."""
> 
> -        if order in self['sqorders_types'].keys():
> +        if order in list(self['sqorders_types'].keys()):
>             return self['sqorders_types'][order]
>         else:
>             # Default behavior '=' is interpreted as upper bound '<='
> @@ -3081,9 +3003,9 @@
>                 'forbidden_onsh_s_channels', 'forbidden_s_channels',
>                 'forbidden_particles', 'is_decay_chain', 'decay_chains',
>                 'legs_with_decays', 'perturbation_couplings', 'has_born', 
> -                'NLO_mode', 'split_orders', 'born_orders']
> +                'NLO_mode', 'split_orders', 'born_sq_orders']
> 
> -    def nice_string(self, indent=0, print_weighted = True, prefix=True):
> +    def nice_string(self, indent=0, print_weighted=True, prefix=True, print_perturbated=True):
>         """Returns a nicely formated string about current process
>         content. Since the WEIGHTED order is automatically set and added to 
>         the user-defined list of orders, it can be ommitted for some info
> @@ -3157,7 +3079,7 @@
>                     for key in sorted(self['constrained_orders'].keys()))  + ' '
> 
>         # Add perturbation_couplings
> -        if self['perturbation_couplings']:
> +        if print_perturbated and self['perturbation_couplings']:
>             mystr = mystr + '[ '
>             if self['NLO_mode']!='tree':
>                 if self['NLO_mode']=='virt' and not self['has_born']:
> @@ -3263,8 +3185,10 @@
>             prevleg = leg
> 
>         if self['orders']:
> +            keys = list(self['orders'].keys())
> +            keys.sort(reverse=True)
>             mystr = mystr + " ".join([key + '=' + repr(self['orders'][key]) \
> -                       for key in self['orders']]) + ' '
> +                       for key in keys]) + ' '
> 
>         # Add squared orders
>         if self['squared_orders']:
> @@ -3276,7 +3200,7 @@
>             mystr = mystr + '[ '
>             if self['NLO_mode']:
>                 mystr = mystr + self['NLO_mode']
> -                if not self['has_born']:
> +                if not self['has_born'] and self['NLO_mode'] != 'noborn':
>                     mystr = mystr + '^2'
>                 mystr = mystr + '= '
> 
> @@ -3370,11 +3294,7 @@
>         prevleg = None
>         if pdg_order:
>             legs = [l for l in self['legs'][1:]]
> -            def order_leg(l1,l2):
> -                id1 = l1.get('id')
> -                id2 = l2.get('id')
> -                return id2-id1
> -            legs.sort(cmp=order_leg)
> +            legs.sort(key=lambda x: x.get('id'))
>             legs.insert(0, self['legs'][0])
>         else:
>             legs = self['legs']
> @@ -3485,8 +3405,8 @@
>         """ Check iteratively that no coupling order constraint include negative
>         values."""
> 
> -        if any(val<0 for val in self.get('orders').values()+\
> -                                           self.get('squared_orders').values()):
> +        if any(val<0 for val in list(self.get('orders').values())+\
> +                                           list(self.get('squared_orders').values())):
>             return True
> 
>         for procdef in self['decay_chains']:
> @@ -3514,22 +3434,19 @@
>     def get_ninitial(self):
>         """Gives number of initial state particles"""
> 
> -        return len(filter(lambda leg: leg.get('state') == False,
> -                           self.get('legs')))
> +        return len([leg for leg in self.get('legs') if leg.get('state') == False])
> 
>     def get_initial_ids(self):
>         """Gives the pdg codes for initial state particles"""
> 
>         return [leg.get('id') for leg in \
> -                filter(lambda leg: leg.get('state') == False,
> -                       self.get('legs'))]
> +                [leg for leg in self.get('legs') if leg.get('state') == False]]
> 
>     def get_initial_pdg(self, number):
>         """Return the pdg codes for initial state particles for beam number"""
> 
> -        legs = filter(lambda leg: leg.get('state') == False and\
> -                       leg.get('number') == number,
> -                       self.get('legs'))
> +        legs = [leg for leg in self.get('legs') if leg.get('state') == False and\
> +                       leg.get('number') == number]
>         if not legs:
>             return None
>         else:
> @@ -3584,8 +3501,7 @@
>     def get_final_legs(self):
>         """Gives the final state legs"""
> 
> -        return filter(lambda leg: leg.get('state') == True,
> -                       self.get('legs'))
> +        return [leg for leg in self.get('legs') if leg.get('state') == True]
> 
>     def get_final_ids(self):
>         """Gives the pdg codes for final state particles"""
> @@ -3665,15 +3581,14 @@
>             return 1
>         if self.list_for_sort() < other.list_for_sort():
>             return -1
> +        assert self.list_for_sort() == other.list_for_sort()
>         return 0
> 
>     def identical_particle_factor(self):
>         """Calculate the denominator factor for identical final state particles
>         """
> 
> -        
> -        final_legs = filter(lambda leg: leg.get('state') == True, \
> -                              self.get_legs_with_decays())
> +        final_legs = [leg for leg in self.get_legs_with_decays() if leg.get('state') == True]
> 
>         identical_indices = collections.defaultdict(int)
>         for leg in final_legs:
> @@ -3697,7 +3612,7 @@
>         for (k,v) in tmp:  
>             if k in orders:
>                 if v < orders[k]:
> -                    if k in sq_orders.keys() and \
> +                    if k in list(sq_orders.keys()) and \
>                                              (sq_orders[k]>v or sq_orders[k]<0):
>                         logger.warning(
> '''The process with the squared coupling order (%s^2%s%s) specified can potentially 
> @@ -3721,7 +3636,9 @@
>         if not isinstance(other, Process):
>             return False
> 
> +        #misc.sprint("can we speed up this computation? Yes we can!")
>         return self.compare_for_sort(other) == 0
> +        return self.list_for_sort() == other.list_for_sort()
> 
>     def __ne__(self, other):
>         return not self.__eq__(other)
> @@ -3770,12 +3687,10 @@
> 
>         if name == 'legs':
>             if not isinstance(value, MultiLegList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid MultiLegList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid MultiLegList object" % str(value))
>         elif name == 'decay_chains':
>             if not isinstance(value, ProcessDefinitionList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ProcessDefinitionList" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ProcessDefinitionList" % str(value))
> 
>         else:
>             return super(ProcessDefinition, self).filter(name, value)
> @@ -4064,7 +3979,7 @@
>             'is_decay_chain': self.get('is_decay_chain'),
>             'overall_orders': self.get('overall_orders'),
>             'split_orders': self.get('split_orders'),
> -            'born_orders': self.get('born_orders'),
> +            'born_sq_orders': self.get('born_sq_orders'),
>             'NLO_mode': self.get('NLO_mode')
>             })
> 
> 
> === modified file 'madgraph/core/color_algebra.py'
> --- madgraph/core/color_algebra.py	2016-01-23 00:40:59 +0000
> +++ madgraph/core/color_algebra.py	2021-03-24 10:12:56 +0000
> @@ -16,11 +16,15 @@
> """Classes and methods required for all calculations related to SU(N) color 
> algebra."""
> 
> +from __future__ import absolute_import
> import array
> import copy
> import fractions
> import itertools
> import madgraph.various.misc as misc
> +from six.moves import map
> +from six.moves import range
> +from six.moves import zip
> 
> #===============================================================================
> # ColorObject
> @@ -31,8 +35,11 @@
> 
>     def __new__(cls, *args):
>         """Create a new ColorObject, assuming an integer array"""
> -        return super(ColorObject, cls).__new__(cls, 'i', args)
> -
> +        try:
> +            return super(ColorObject, cls).__new__(cls, 'i', args)
> +        except TypeError:
> +            assert args[0] == 'i' #happens when unpacking pickle with py3
> +            return super(ColorObject, cls).__new__(cls, 'i', args[1])
>     def __reduce__(self):
>         """Special method needed to pickle color objects correctly"""
>         return (self.__class__, tuple([i for i in self]))
> @@ -174,6 +181,10 @@
>     def __init__(self, *args):
>         """Check for no index"""
> 
> +        if len(args) ==2 and args[0] == 'i' and not args[1]:
> +            # py3 pickle wierd output some time...
> +            return super(ColorOne, self).__init__()
> +            
>         assert len(args) == 0 , "ColorOne objects must have no index!"
> 
>         super(ColorOne, self).__init__()
> @@ -296,6 +307,9 @@
>     def __init__(self, *args):
>         """Ensure f and d objects have strictly 3 indices"""
> 
> +        # for py3 from pickle
> +        if len(args) !=3 and args[0] == 'i':
> +            args = args[1]
>         assert len(args) == 3, "f and d objects must have three indices!"
> 
>         super(f, self).__init__()
> @@ -808,7 +822,7 @@
>         dictionary written as {old_index:new_index,...}, does that for ALL 
>         color objects."""
> 
> -        map(lambda col_obj: col_obj.replace_indices(repl_dict), self)
> +        list(map(lambda col_obj: col_obj.replace_indices(repl_dict), self))
> 
>     def create_copy(self):
>         """Returns a real copy of self, non trivial because bug in 
> @@ -833,8 +847,7 @@
>         are still non trivial color objects."""
> 
>         if self:
> -            raise ValueError, \
> -                "String %s cannot be simplified to a number!" % str(self)
> +            raise ValueError("String %s cannot be simplified to a number!" % str(self))
> 
>         if self.Nc_power >= 0:
>             return (self.coeff * fractions.Fraction(\
> @@ -1050,7 +1063,7 @@
>         dictionary written as {old_index:new_index,...}, does that for ALL 
>         color strings."""
> 
> -        map(lambda col_str:col_str.replace_indices(repl_dict), self)
> +        list(map(lambda col_str:col_str.replace_indices(repl_dict), self))
> 
>     def create_copy(self):
>         """Returns a real copy of self, non trivial because bug in 
> 
> === modified file 'madgraph/core/color_amp.py'
> --- madgraph/core/color_amp.py	2015-10-01 16:00:08 +0000
> +++ madgraph/core/color_amp.py	2021-03-24 10:12:56 +0000
> @@ -17,15 +17,20 @@
> for a diagram and build a color basis, and to square a QCD color string for
> squared diagrams and interference terms."""
> 
> +from __future__ import absolute_import
> import copy
> import fractions
> import operator
> import re
> import array
> +import math
> +import six
> 
> import madgraph.core.color_algebra as color_algebra
> import madgraph.core.diagram_generation as diagram_generation
> import madgraph.core.base_objects as base_objects
> +from six.moves import range
> +from functools import reduce
> 
> #===============================================================================
> # ColorBasis
> @@ -413,8 +418,7 @@
>         # If more than one string at leading N...
>         if len(res_cs) > 1 and any([not cs.near_equivalent(res_cs[0]) \
>                                     for cs in res_cs]):
> -            raise ColorBasis.ColorBasisError, \
> -             "More than one color string with leading N coeff: %s" % str(res_cs)
> +            raise ColorBasis.ColorBasisError("More than one color string with leading N coeff: %s" % str(res_cs))
> 
>         res_cs = res_cs[0]
> 
> @@ -423,13 +427,11 @@
>         for col_obj in res_cs:
>             if not isinstance(col_obj, color_algebra.T) and \
>                    not col_obj.__class__.__name__.startswith('Epsilon'):
> -                raise ColorBasis.ColorBasisError, \
> -                  "Color flow decomposition %s contains non T/Epsilon elements" % \
> -                                                                    str(res_cs)
> +                raise ColorBasis.ColorBasisError("Color flow decomposition %s contains non T/Epsilon elements" % \
> +                                                                    str(res_cs))
>             if isinstance(col_obj, color_algebra.T) and len(col_obj) != 2:
> -                raise ColorBasis.ColorBasisError, \
> -                  "Color flow decomposition %s contains T's w/o 2 indices" % \
> -                                                                    str(res_cs)
> +                raise ColorBasis.ColorBasisError("Color flow decomposition %s contains T's w/o 2 indices" % \
> +                                                                    str(res_cs))
> 
>         return res_cs
> 
> @@ -463,8 +465,7 @@
> 
>                 # Raise an error if external legs contain non supported repr
>                 if abs(leg_repr) not in [1, 3, 6, 8]:
> -                    raise ColorBasis.ColorBasisError, \
> -        "Particle ID=%i has an unsupported color representation" % leg_repr
> +                    raise ColorBasis.ColorBasisError("Particle ID=%i has an unsupported color representation" % leg_repr)
> 
>                 # Build the fake indices replacements for octets
>                 if abs(leg_repr) == 8:
> @@ -614,7 +615,7 @@
>                 if is_symmetric:
>                     self.col_matrix_fixed_Nc[(i2, i1)] = result_fixed_Nc
>                 # and update the inverted dict
> -                if result_fixed_Nc in self.inverted_col_matrix.keys():
> +                if result_fixed_Nc in list(self.inverted_col_matrix.keys()):
>                     self.inverted_col_matrix[result_fixed_Nc].append((i1,
>                                                                       i2))
>                     if is_symmetric:
> @@ -734,8 +735,10 @@
>     @staticmethod
>     def lcm(a, b):
>         """Return lowest common multiple."""
> -        return a * b // fractions.gcd(a, b)
> -
> +        if six.PY2:
> +            return a * b // fractions.gcd(a, b)
> +        else:
> +            return a * b // math.gcd(a, b)
>     @staticmethod
>     def lcmm(*args):
>         """Return lcm of args."""
> 
> === modified file 'madgraph/core/diagram_generation.py'
> --- madgraph/core/diagram_generation.py	2020-06-30 12:23:40 +0000
> +++ madgraph/core/diagram_generation.py	2021-03-24 10:12:56 +0000
> @@ -19,6 +19,10 @@
> based on relevant properties.
> """
> 
> +from __future__ import absolute_import
> +from six.moves import filter
> +#force filter to be a generator # like in py3
> +
> import array
> import copy
> import itertools
> @@ -27,6 +31,9 @@
> import madgraph.core.base_objects as base_objects
> import madgraph.various.misc as misc
> from madgraph import InvalidCmd, MadGraph5Error
> +from six.moves import range
> +from six.moves import zip
> +from six.moves import filter
> 
> logger = logging.getLogger('madgraph.diagram_generation')
> 
> @@ -152,8 +159,8 @@
>         leg_vertices = [cls.vertices_from_link(l, model) for l in link.links]
>         # The daughter legs are in the first entry
>         legs = base_objects.LegList(sorted([l for l,v in leg_vertices],
> -                                           lambda l1,l2: l2.get('number') - \
> -                                           l1.get('number')))
> +                                           key= lambda l: l.get('number'), reverse=True))
> +
>         # The daughter vertices are in the second entry
>         vertices = base_objects.VertexList(sum([v for l, v in leg_vertices],
>                                                []))
> @@ -260,7 +267,7 @@
>         """Reorder a permutation with respect to start_perm. Note that
>         both need to start from 1."""
>         if perm == start_perm:
> -            return range(len(perm))
> +            return list(range(len(perm)))
>         order = [i for (p,i) in \
>                  sorted([(p,i) for (i,p) in enumerate(perm)])]
>         return [start_perm[i]-1 for i in order]
> @@ -366,7 +373,23 @@
>             return len(self.links) < len(other.links)
> 
>         if self.vertex_id[0] != other.vertex_id[0]:
> -            return self.vertex_id[0] < other.vertex_id[0]
> +            if isinstance(self.vertex_id[0], int) and isinstance(other.vertex_id[0], tuple):
> +                return True
> +            elif isinstance(self.vertex_id[0], tuple) and isinstance(other.vertex_id[0], int):
> +                return False
> +            elif isinstance(self.vertex_id[0], str) and isinstance(other.vertex_id[0], tuple):
> +                return True
> +            elif isinstance(self.vertex_id[0], tuple) and isinstance(other.vertex_id[0], str):
> +                return False            
> +            else:
> +                try:
> +                    return self.vertex_id[0] < other.vertex_id[0]
> +                except TypeError as error:
> +                    if error.args == "'<' not supported between instances of 'tuple' and 'str'":
> +                        return False
> +                    else:
> +                        return True
> +                    
> 
>         for i, link in enumerate(self.links):
>             if i > len(other.links) - 1:
> @@ -439,16 +462,13 @@
> 
>         if name == 'process':
>             if not isinstance(value, base_objects.Process):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid Process object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid Process object" % str(value))
>         if name == 'diagrams':
>             if not isinstance(value, base_objects.DiagramList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid DiagramList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid DiagramList object" % str(value))
>         if name == 'has_mirror_process':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid boolean" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid boolean" % str(value))
>         return True
> 
>     def get(self, name):
> @@ -554,7 +574,7 @@
>                                      process.get('overall_orders')[key])
>             except KeyError:
>                 process.get('orders')[key] = process.get('overall_orders')[key]
> -
> +                
>         assert model.get('particles'), \
>            "particles are missing in model: %s" %  model.get('particles')
> 
> @@ -564,22 +584,22 @@
> 
>         res = base_objects.DiagramList()
>         # First check that the number of fermions is even
> -        if len(filter(lambda leg: model.get('particle_dict')[\
> -                        leg.get('id')].is_fermion(), legs)) % 2 == 1:
> +        if len([leg for leg in legs if model.get('particle_dict')[\
> +                        leg.get('id')].is_fermion()]) % 2 == 1:
>             if not returndiag:
>                 self['diagrams'] = res
> -                raise InvalidCmd, 'The number of fermion is odd'
> +                raise InvalidCmd('The number of fermion is odd')
>             else:
>                 return False, res
> 
>         # Then check same number of incoming and outgoing fermions (if
>         # no Majorana particles in model)
>         if not model.get('got_majoranas') and \
> -           len(filter(lambda leg: leg.is_incoming_fermion(model), legs)) != \
> -           len(filter(lambda leg: leg.is_outgoing_fermion(model), legs)):
> +           len([leg for leg in legs if leg.is_incoming_fermion(model)]) != \
> +           len([leg for leg in legs if leg.is_outgoing_fermion(model)]):
>             if not returndiag:
>                 self['diagrams'] = res
> -                raise InvalidCmd, 'The number of of incoming/outcoming fermions are different'
> +                raise InvalidCmd('The number of of incoming/outcoming fermions are different')
>             else:
>                 return False, res
> 
> @@ -605,10 +625,10 @@
>             if abs(total) > 1e-10:
>                 if not returndiag:
>                     self['diagrams'] = res
> -                    raise InvalidCmd, 'No %s conservation for this process ' % charge
> +                    raise InvalidCmd('No %s conservation for this process ' % charge)
>                     return res
>                 else:
> -                    raise InvalidCmd, 'No %s conservation for this process ' % charge
> +                    raise InvalidCmd('No %s conservation for this process ' % charge)
>                     return res, res
> 
>         if not returndiag:
> @@ -699,19 +719,17 @@
>             # extra vertex corresponding to particle 1=1, so we need
>             # to exclude the two last vertexes.
>             if is_decay_proc: lastvx = -2
> -            ninitial = len(filter(lambda leg: leg.get('state') == False,
> -                                  process.get('legs')))
> +            ninitial = len([leg for leg in process.get('legs') if leg.get('state') == False])
>             # Check required s-channels for each list in required_s_channels
>             old_res = res
>             res = base_objects.DiagramList()
>             for id_list in process.get('required_s_channels'):
> -                res_diags = filter(lambda diagram: \
> -                          all([req_s_channel in \
> +                res_diags = [diagram for diagram in old_res if all([req_s_channel in \
>                                [vertex.get_s_channel_id(\
>                                process.get('model'), ninitial) \
>                                for vertex in diagram.get('vertices')[:lastvx]] \
>                                for req_s_channel in \
> -                               id_list]), old_res)
> +                               id_list])]
>                 # Add diagrams only if not already in res
>                 res.extend([diag for diag in res_diags if diag not in res])
> 
> @@ -720,16 +738,13 @@
>         # Note that we shouldn't look at the last vertex in each
>         # diagram, since that is the n->0 vertex
>         if process.get('forbidden_s_channels'):
> -            ninitial = len(filter(lambda leg: leg.get('state') == False,
> -                                  process.get('legs')))
> +            ninitial = len([leg for leg in process.get('legs') if leg.get('state') == False])
>             if ninitial == 2:
>                 res = base_objects.DiagramList(\
> -                filter(lambda diagram: \
> -                       not any([vertex.get_s_channel_id(\
> +                [diagram for diagram in res if not any([vertex.get_s_channel_id(\
>                            process.get('model'), ninitial) \
>                                 in process.get('forbidden_s_channels')
> -                                for vertex in diagram.get('vertices')[:-1]]),
> -                       res))
> +                                for vertex in diagram.get('vertices')[:-1]])])
>             else:
>                 # split since we need to avoid that the initial particle is forbidden 
>                 # as well. 
> @@ -742,7 +757,7 @@
>                     vertex =  diagram.get('vertices')[-1]
>                     if any([l['number'] ==1 for l in vertex.get('legs')]):
>                         leg1 = [l['number'] for l in vertex.get('legs') if l['number'] !=1][0]
> -                    to_loop = range(len(diagram.get('vertices'))-1)
> +                    to_loop = list(range(len(diagram.get('vertices'))-1))
>                     if leg1 >1:   
>                         to_loop.reverse()
>                     for i in to_loop:
> @@ -762,8 +777,7 @@
>         # Mark forbidden (onshell) s-channel propagators, to forbid onshell
>         # generation.
>         if process.get('forbidden_onsh_s_channels'):
> -            ninitial = len(filter(lambda leg: leg.get('state') == False,
> -                              process.get('legs')))
> +            ninitial = len([leg for leg in process.get('legs') if leg.get('state') == False])
> 
>             verts = base_objects.VertexList(sum([[vertex for vertex \
>                                                   in diagram.get('vertices')[:-1]
> @@ -808,8 +822,7 @@
>                     nexttolastvertex = copy.copy(vertices.pop())
>                     legs = copy.copy(nexttolastvertex.get('legs'))
>                     ntlnumber = legs[-1].get('number')
> -                    lastleg = filter(lambda leg: leg.get('number') != ntlnumber,
> -                                     lastvx.get('legs'))[0]
> +                    lastleg = [leg for leg in lastvx.get('legs') if leg.get('number') != ntlnumber][0]
>                     # Reset onshell in case we have forbidden s-channels
>                     if lastleg.get('onshell') == False:
>                         lastleg.set('onshell', None)
> @@ -1176,8 +1189,7 @@
>                     number = min([leg.get('number') for leg in entry])
>                     # 3) state is final, unless there is exactly one initial 
>                     # state particle involved in the combination -> t-channel
> -                    if len(filter(lambda leg: leg.get('state') == False,
> -                                  entry)) == 1:
> +                    if len([leg for leg in entry if leg.get('state') == False]) == 1:
>                         state = False
>                     else:
>                         state = True
> @@ -1362,15 +1374,13 @@
> 
>             for process in argument.get('decay_chains'):
>                 if process.get('perturbation_couplings'):
> -                    raise MadGraph5Error,\
> -                          "Decay processes can not be perturbed"
> +                    raise MadGraph5Error("Decay processes can not be perturbed")
>                 process.set('overall_orders', argument.get('overall_orders'))
>                 if not process.get('is_decay_chain'):
>                     process.set('is_decay_chain',True)
>                 if not process.get_ninitial() == 1:
> -                    raise InvalidCmd,\
> -                          "Decay chain process must have exactly one" + \
> -                          " incoming particle"
> +                    raise InvalidCmd("Decay chain process must have exactly one" + \
> +                          " incoming particle")
>                 self['decay_chains'].append(\
>                     DecayChainAmplitude(process, collect_mirror_procs,
>                                         ignore_six_quark_processes,
> @@ -1443,13 +1453,11 @@
> 
>         if name == 'amplitudes':
>             if not isinstance(value, AmplitudeList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid AmplitudeList" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid AmplitudeList" % str(value))
>         if name == 'decay_chains':
>             if not isinstance(value, DecayChainAmplitudeList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid DecayChainAmplitudeList object" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid DecayChainAmplitudeList object" % \
> +                        str(value))
>         return True
> 
>     def get_sorted_keys(self):
> @@ -1601,23 +1609,19 @@
> 
>         if name == 'process_definitions':
>             if not isinstance(value, base_objects.ProcessDefinitionList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ProcessDefinitionList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ProcessDefinitionList object" % str(value))
> 
>         if name == 'amplitudes':
>             if not isinstance(value, AmplitudeList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid AmplitudeList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid AmplitudeList object" % str(value))
> 
>         if name in ['collect_mirror_procs']:
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid boolean" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid boolean" % str(value))
> 
>         if name == 'ignore_six_quark_processes':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list" % str(value))
> 
>         return True
> 
> @@ -1649,6 +1653,10 @@
>         """Return process property names as a nicely sorted list."""
> 
>         return ['process_definitions', 'amplitudes']
> +    
> +    def get_model(self):
> +        
> +        return self['process_definitions'][0]['model']
> 
>     @classmethod
>     def generate_multi_amplitudes(cls,process_definition,
> @@ -1667,9 +1675,9 @@
>                                     "%s not valid ProcessDefinition object" % \
>                                     repr(process_definition)
> 
> -        # Set automatic coupling orders if born_orders are not specified
> +        # Set automatic coupling orders if born_sq_orders are not specified
>         # otherwise skip
> -        if not process_definition['born_orders']:
> +        if not process_definition['born_sq_orders']:
>             process_definition.set('orders', MultiProcess.\
>                                find_optimal_process_orders(process_definition,
>                                                            diagram_filter))
> @@ -1842,9 +1850,8 @@
>             if len(failed_procs) == 1 and 'error' in locals():
>                 raise error
>             else:
> -                raise NoDiagramException, \
> -            "No amplitudes generated from process %s. Please enter a valid process" % \
> -                  process_definition.nice_string()
> +                raise NoDiagramException("No amplitudes generated from process %s. Please enter a valid process" % \
> +                  process_definition.nice_string())
> 
> 
>         # Return the produced amplitudes
> @@ -1926,16 +1933,16 @@
> 
>         # Extract the initial and final leg ids
>         isids = [leg['ids'] for leg in \
> -                 filter(lambda leg: leg['state'] == False, process_definition['legs'])]
> +                 [leg for leg in process_definition['legs'] if leg['state'] == False]]
>         fsids = [leg['ids'] for leg in \
> -                 filter(lambda leg: leg['state'] == True, process_definition['legs'])]
> +                 [leg for leg in process_definition['legs'] if leg['state'] == True]]
> 
>         max_WEIGHTED_order = \
>                         (len(fsids + isids) - 2)*int(model.get_max_WEIGHTED())
>         # get the definition of the WEIGHTED
>         hierarchydef = process_definition['model'].get('order_hierarchy')
>         tmp = []
> -        hierarchy = hierarchydef.items()
> +        hierarchy = list(hierarchydef.items())
>         hierarchy.sort()
>         for key, value in hierarchydef.items():
>             if value>1:
> @@ -1955,7 +1962,7 @@
>             # based on crossing symmetry
>             failed_procs = []
>             # Generate all combinations for the initial state        
> -            for prod in apply(itertools.product, isids):
> +            for prod in itertools.product(*isids):
>                 islegs = [ base_objects.Leg({'id':id, 'state': False}) \
>                         for id in prod]
> 
> @@ -1964,7 +1971,7 @@
> 
>                 red_fsidlist = []
> 
> -                for prod in apply(itertools.product, fsids):
> +                for prod in itertools.product(*fsids):
> 
>                     # Remove double counting between final states
>                     if tuple(sorted(prod)) in red_fsidlist:
> @@ -2033,7 +2040,7 @@
>                     amplitude = Amplitude({'process': process})
>                     try:
>                         amplitude.generate_diagrams(diagram_filter=diagram_filter)
> -                    except InvalidCmd, error:
> +                    except InvalidCmd as error:
>                         failed_procs.append(tuple(sorted_legs))
>                     else:
>                         if amplitude.get('diagrams'):
> @@ -2053,7 +2060,7 @@
>     def cross_amplitude(amplitude, process, org_perm, new_perm):
>         """Return the amplitude crossed with the permutation new_perm"""
>         # Create dict from original leg numbers to new leg numbers
> -        perm_map = dict(zip(org_perm, new_perm))
> +        perm_map = dict(list(zip(org_perm, new_perm)))
>         # Initiate new amplitude
>         new_amp = copy.copy(amplitude)
>         # Number legs
> @@ -2094,7 +2101,7 @@
>         else:
>             tmplist.append([item])
> 
> -    for item in apply(itertools.product, tmplist):
> +    for item in itertools.product(*tmplist):
>         res.append(list(item))
> 
>     return res
> 
> === modified file 'madgraph/core/drawing.py'
> --- madgraph/core/drawing.py	2020-03-09 09:27:32 +0000
> +++ madgraph/core/drawing.py	2021-03-24 10:12:56 +0000
> @@ -42,11 +42,14 @@
> 
> from __future__ import division
> 
> +from __future__ import absolute_import
> import math
> 
> import madgraph.core.base_objects as base_objects
> import madgraph.loop.loop_base_objects as loop_objects
> import madgraph.various.misc as misc
> +import six
> +from six.moves import range
> 
> #===============================================================================
> # FeynmanLine
> @@ -428,8 +431,8 @@
>             self.begin.pos_x
>             self.end.pos_y
>         except Exception:
> -            raise self.FeynmanLineError, 'No vertex in begin-end position ' + \
> -                        ' or no position attach at one of those vertex '
> +            raise self.FeynmanLineError('No vertex in begin-end position ' + \
> +                        ' or no position attach at one of those vertex ')
>         return True
> 
>     def has_ordinate(self, x):
> @@ -447,10 +450,10 @@
>                 min, max = max, min
> 
>             if min == max:
> -                raise self.FeynmanLineError, 'Vertical line: no unique solution'
> +                raise self.FeynmanLineError('Vertical line: no unique solution')
>             if(not(min <= x <= max)):
> -                raise self.FeynmanLineError, 'point outside interval invalid ' + \
> -                    'invalid order {0:3}<={1:3}<={2:3}'.format(min, x, max)
> +                raise self.FeynmanLineError('point outside interval invalid ' + \
> +                    'invalid order {0:3}<={1:3}<={2:3}'.format(min, x, max))
> 
>         return self._has_ordinate(x)
> 
> @@ -564,8 +567,8 @@
>                 del self.lines[i]
>                 return # only one data to remove!
> 
> -        raise self.VertexPointError, 'trying to remove in a ' + \
> -                            'Vertex_Point a non present Feynman_Line'
> +        raise self.VertexPointError('trying to remove in a ' + \
> +                            'Vertex_Point a non present Feynman_Line')
> 
> 
>     def def_level(self, level):
> @@ -1076,9 +1079,8 @@
>             # Associate position to level 2 and following (auto-recursive fct)
>             self.find_vertex_position_at_level([init_line.end], 2)
>         else:
> -            raise self.FeynamDiagramError, \
> -                                'only for one or two initial particles not %s' \
> -                                % (len(self.initial_vertex))
> +            raise self.FeynamDiagramError('only for one or two initial particles not %s' \
> +                                % (len(self.initial_vertex)))
> 
> 
>     def find_vertex_position_tchannel(self):
> @@ -1658,7 +1660,7 @@
>         #No need to test Diagram class, it will be tested before using it anyway
>         try:
>             assert(not model or isinstance(model, base_objects.Model))
> -            assert(not filename or isinstance(filename, basestring))
> +            assert(not filename or isinstance(filename, six.string_types))
>         except AssertionError:
>             raise self.DrawDiagramError('No valid model provide to convert ' + \
>                                         'diagram in appropriate format')
> @@ -1931,7 +1933,7 @@
>         if hasattr(self, 'draw_curved_' + line_type):
>             getattr(self, 'draw_curved_' + line_type)(line, cercle)
>         else:
> -            self.draw_curved_straight(line, reduce)
> +            self.draw_curved_straight(line, cercle)
> 
>         # Finalize the line representation with adding the name of the particle
>         name = line.get_name()
> @@ -1953,8 +1955,8 @@
>         straight is an example and can be replace by other type of line as 
>         dashed, wavy, curly, ..."""
> 
> -        raise self.DrawDiagramError, 'DrawDiagram.draw_straight should be ' + \
> -                'overwritten by Inherited Class'
> +        raise self.DrawDiagramError('DrawDiagram.draw_straight should be ' + \
> +                'overwritten by Inherited Class')
> 
>     draw_curved_straight = draw_straight
> 
> @@ -2274,7 +2276,7 @@
> 
> 
>             for line in vertex['legs'][:-1]:
> -                if binding_side.has_key(line.get('number')):
> +                if line.get('number') in binding_side:
>                     pass
>                 binding_side[line.get('number')] = left_direction
> 
> @@ -2298,7 +2300,7 @@
>                         continue # connecting to initial particles
>                     #compute the number of vertex in the structure
>                     nb_vertex = len(self.fdstructures[structure_id].get('vertices'))
> -                    if not binding_side.has_key(leg.get('number')):
> +                    if leg.get('number') not in binding_side:
>                         continue
> 
>                     if  binding_side[leg.get('number')]:
> @@ -2361,16 +2363,8 @@
>             if nb_Tloop % 2:
>                 direction = 1
> 
> -        def order(line1, line2):
> -            """ put T-channel first """
> -            if line1.state == line2.state:
> -                return 0
> -            if line2.state:
> -                return -1
> -            else:
> -                return 1
> 
> -        vertex.lines.sort(order)
> +        vertex.lines.sort(key=lambda l: l.state)
>         for line in vertex.lines:
>             if line.begin.level is not None and line.end.level is not None:
>                 continue # everything correctly define
> 
> === modified file 'madgraph/core/helas_objects.py'
> --- madgraph/core/helas_objects.py	2020-05-07 09:07:13 +0000
> +++ madgraph/core/helas_objects.py	2021-03-24 10:12:56 +0000
> @@ -13,6 +13,7 @@
> #
> ################################################################################
> from __future__ import division
> +from __future__ import absolute_import
> """Definitions of objects used to generate language-independent Helas
> calls: HelasWavefunction, HelasAmplitude, HelasDiagram for the
> generation of wavefunctions and amplitudes, HelasMatrixElement and
> @@ -39,6 +40,10 @@
> import madgraph.various.misc as misc
> 
> from madgraph import InvalidCmd, MadGraph5Error
> +import six
> +from six.moves import range
> +from six.moves import zip
> +from functools import reduce
> 
> #===============================================================================
> # 
> @@ -303,8 +308,7 @@
>                         right_num = num
>             if right_num == -1:
>                 # This should never happen
> -                raise diagram_generation.DiagramTag.DiagramTagError, \
> -                    "Error in CanonicalConfigTag, no link with number 1 or 2."
> +                raise diagram_generation.DiagramTag.DiagramTagError("Error in CanonicalConfigTag, no link with number 1 or 2.")
> 
>             # Now move one step in the direction of right_link
>             right_link = self.tag.links[right_num]
> @@ -405,11 +409,9 @@
>             # Sort the legs
>             legs = vertex.get('legs')[:-1]
>             if vertex in schannels:
> -                legs.sort(lambda l1, l2: l2.get('number') - \
> -                          l1.get('number'))
> +                legs.sort(key=lambda l: l.get('number'), reverse=True)
>             else:
> -                legs.sort(lambda l1, l2: l1.get('number') - \
> -                          l2.get('number'))
> +                legs.sort(key=lambda l: l.get('number'))
>             for ileg,leg in enumerate(legs):
>                 newleg = copy.copy(leg)
>                 try:
> @@ -495,8 +497,7 @@
>             return (old_vertex[0], (new_vertex[1][0], min_number), new_vertex[2])
> 
>         # We should not get here
> -        raise diagram_generation.DiagramTag.DiagramTagError, \
> -              "Error in CanonicalConfigTag, wrong setup of vertices in link."
> +        raise diagram_generation.DiagramTag.DiagramTagError("Error in CanonicalConfigTag, wrong setup of vertices in link.")
> 
>     @staticmethod
>     def leg_from_link(link):
> @@ -562,7 +563,7 @@
>         try:
>             return sizes[abs(spin)]
>         except KeyError:
> -            raise MadGraph5Error, "L-cut particle has spin %d which is not supported."%spin
> +            raise MadGraph5Error("L-cut particle has spin %d which is not supported."%spin)
> 
>     def default_setup(self):
>         """Default values for all properties"""
> @@ -712,158 +713,131 @@
> 
>         if name in ['particle', 'antiparticle']:
>             if not isinstance(value, base_objects.Particle):
> -                raise self.PhysicsObjectError, \
> -                    "%s tag %s is not a particle" % (name, repr(value))            
> +                raise self.PhysicsObjectError("%s tag %s is not a particle" % (name, repr(value)))            
> 
> -        if name == 'is_part':
> +        elif name == 'is_part':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                    "%s tag %s is not a boolean" % (name, repr(value))
> +                raise self.PhysicsObjectError("%s tag %s is not a boolean" % (name, repr(value)))
> 
> -        if name == 'interaction_id':
> +        elif name == 'interaction_id':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer " % str(value) + \
> -                        " for wavefunction interaction id"
> +                raise self.PhysicsObjectError("%s is not a valid integer " % str(value) + \
> +                        " for wavefunction interaction id")
> 
> -        if name == 'pdg_codes':
> +        elif name == 'pdg_codes':
>             #Should be a list of strings
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of integers" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
>             for mystr in value:
>                 if not isinstance(mystr, int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(mystr)
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(mystr))
> 
> -        if name == 'orders':
> +        elif name == 'orders':
>             #Should be a dict with valid order names ask keys and int as values
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dict for coupling orders" % \
> -                                                                    str(value)
> +                raise self.PhysicsObjectError("%s is not a valid dict for coupling orders" % \
> +                                                                    str(value))
>             for order in value.keys():
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(order)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(order))
>                 if not isinstance(value[order], int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value[order])
> -
> -
> -        if name == 'inter_color':
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(value[order]))
> +
> +
> +        elif name == 'inter_color':
>             # Should be None or a color string
>             if value and not isinstance(value, color.ColorString):
> -                    raise self.PhysicsObjectError, \
> -                            "%s is not a valid Color String" % str(value)
> -
> -        if name == 'lorentz':
> -            #Should be a list of string
> -            if not isinstance(value, list):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> -            for name in value:
> -                if not isinstance(name, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s doesn't contain only string" % str(value)
> -
> -        if name == 'coupling':
> -            #Should be a list of string
> -            if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid coupling string" % str(value)
> -            for name in value:
> -                if not isinstance(name, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s doesn't contain only string" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid Color String" % str(value))
> +
> +        elif name == 'lorentz':
> +            #Should be a list of string
> +            if not isinstance(value, list):
> +                    raise self.PhysicsObjectError("%s is not a valid list" % str(value))
> +            for name in value:
> +                if not isinstance(name, str):
> +                    raise self.PhysicsObjectError("%s doesn't contain only string" % str(value))
> +
> +        elif name == 'coupling':
> +            #Should be a list of string
> +            if not isinstance(value, list):
> +                raise self.PhysicsObjectError("%s is not a valid coupling string" % str(value))
> +            for name in value:
> +                if not isinstance(name, str):
> +                    raise self.PhysicsObjectError("%s doesn't contain only string" % str(value))
>             if len(value) == 0:
> -                raise self.PhysicsObjectError, \
> -                        "%s should have at least one value" % str(value)
> +                raise self.PhysicsObjectError("%s should have at least one value" % str(value))
> 
> -        if name == 'color_key':
> +        elif name == 'color_key':
>             if value and not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                      "%s is not a valid integer" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer" % str(value))
> 
> -        if name == 'state':
> +        elif name == 'state':
>             if not isinstance(value, str):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid string for wavefunction state" % \
> -                                                                    str(value)
> +                raise self.PhysicsObjectError("%s is not a valid string for wavefunction state" % \
> +                                                                    str(value))
>             if value not in ['incoming', 'outgoing',
>                              'intermediate', 'initial', 'final']:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid wavefunction " % str(value) + \
> -                        "state (incoming|outgoing|intermediate)"
> -        if name == 'leg_state':
> +                raise self.PhysicsObjectError("%s is not a valid wavefunction " % str(value) + \
> +                        "state (incoming|outgoing|intermediate)")
> +        elif name == 'leg_state':
>             if value not in [False, True]:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid wavefunction " % str(value) + \
> -                        "state (incoming|outgoing|intermediate)"
> -        if name in ['fermionflow']:
> +                raise self.PhysicsObjectError("%s is not a valid wavefunction " % str(value) + \
> +                        "state (incoming|outgoing|intermediate)")
> +        elif name in ['fermionflow']:
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer" % str(value))
>             if not value in [-1, 1]:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid sign (must be -1 or 1)" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid sign (must be -1 or 1)" % str(value))
> 
> -        if name in ['number_external', 'number']:
> +        elif name in ['number_external', 'number']:
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value) + \
> -                        " for wavefunction number"
> +                raise self.PhysicsObjectError("%s is not a valid integer" % str(value) + \
> +                        " for wavefunction number")
> 
> -        if name == 'mothers':
> +        elif name == 'mothers':
>             if not isinstance(value, HelasWavefunctionList):
> -                raise self.PhysicsObjectError, \
> -                      "%s is not a valid list of mothers for wavefunction" % \
> -                      str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of mothers for wavefunction" % \
> +                      str(value))
> 
> -        if name in ['decay']:
> +        elif name in ['decay']:
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid bool" % str(value) + \
> -                        " for decay"
> +                raise self.PhysicsObjectError("%s is not a valid bool" % str(value) + \
> +                        " for decay")
> 
> -        if name in ['onshell']:
> +        elif name in ['onshell']:
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid bool" % str(value) + \
> -                        " for onshell"
> +                raise self.PhysicsObjectError("%s is not a valid bool" % str(value) + \
> +                        " for onshell")
> 
> -        if name in ['is_loop']:
> +        elif name in ['is_loop']:
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid bool" % str(value) + \
> -                        " for is_loop"
> +                raise self.PhysicsObjectError("%s is not a valid bool" % str(value) + \
> +                        " for is_loop")
> 
> -        if name == 'conjugate_indices':
> +        elif name == 'conjugate_indices':
>             if not isinstance(value, tuple) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid tuple" % str(value) + \
> -                        " for conjugate_indices"
> -
> -        if name == 'rank':
> -            if not isinstance(value, int) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid int" % str(value) + \
> -                        " for the rank"
> -
> -        if name == 'lcut_size':
> -            if not isinstance(value, int) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid int" % str(value) + \
> -                        " for the lcut_size"
> +                raise self.PhysicsObjectError("%s is not a valid tuple" % str(value) + \
> +                        " for conjugate_indices")
> +
> +        elif name == 'rank':
> +            if not isinstance(value, int) and value != None:
> +                raise self.PhysicsObjectError("%s is not a valid int" % str(value) + \
> +                        " for the rank")
> +
> +        elif name == 'lcut_size':
> +            if not isinstance(value, int) and value != None:
> +                raise self.PhysicsObjectError( \
> +                        "%s is not a valid int" % str(value) + \
> +                        " for the lcut_size")
> 
> -        if name == 'polarization':
> +        elif name == 'polarization':
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list" % str(value)
> +                raise self.PhysicsObjectError( \
> +                        "%s is not a valid list" % str(value))
>             for i in value:
>                 if i not in [-1, 1, 2, -2, 3, -3, 0, 99]:
> -                    raise self.PhysicsObjectError, \
> -                      "%s is not a valid polarization" % str(value)
> +                    raise self.PhysicsObjectError( \
> +                      "%s is not a valid polarization" % str(value))
> 
>         return True
> 
> @@ -929,7 +903,7 @@
>                     if inter.get('lorentz'):
>                         self.set('lorentz', [inter.get('lorentz')[0]])
>                     if inter.get('couplings'):
> -                        self.set('coupling', [inter.get('couplings').values()[0]])
> +                        self.set('coupling', [list(inter.get('couplings').values())[0]])
>                 return True
>             elif name == 'particle':
>                 self.set('particle', model.get('particle_dict')[value])
> @@ -940,8 +914,7 @@
>                     self.set('antiparticle', model.get('particle_dict')[-value])
>                 return True
>             else:
> -                raise self.PhysicsObjectError, \
> -                      "%s not allowed name for 3-argument set", name
> +                six.reraise(self.PhysicsObjectError("%s not allowed name for 3-argument set", name))
>         else:
>             return super(HelasWavefunction, self).set(name, value)
> 
> @@ -974,6 +947,22 @@
>     def is_majorana(self):
>         return self.is_fermion() and self.get('self_antipart')
> 
> +    def is_t_channel(self):
> +        
> +        ninitial = 2
> +        if self.get('number_external') > ninitial:
> +            return False
> +        if self['mothers']:
> +            nb_t_channel= sum(int(wf.is_t_channel()) for wf in self['mothers'])
> +        else:
> +            return True
> +            
> +        if nb_t_channel == 1:
> +            return True
> +        else:
> +            return False
> +        
> +    
>     def get_analytic_info(self, info, alohaModel=None):
>         """ Returns a given analytic information about this loop wavefunction or
>         its characterizing interaction. The list of available information is in
> @@ -999,10 +988,10 @@
>         except KeyError:
>             # It then need be computed and for this, an alohaModel is necessary
>             if alohaModel is None:
> -                raise MadGraph5Error,"The analytic information %s has"%info+\
> +                raise MadGraph5Error("The analytic information %s has"%info+\
>                 " not been computed yet for this wavefunction and an"+\
>                 " alohaModel was not specified, so that the information"+\
> -                " cannot be retrieved."
> +                " cannot be retrieved.")
>         result = None
> 
>         if info=="interaction_rank" and len(self['mothers'])==0:
> @@ -1019,6 +1008,7 @@
>             aloha_info = self.get_aloha_info(True)
>             # aloha_info[0] is the tuple of all lorent structures for this lwf,
>             # aloha_info[1] are the tags and aloha_info[2] is the outgoing number.
> +
>             max_rank = max([ alohaModel.get_info('rank', lorentz,
>                                  aloha_info[2], aloha_info[1], cached=True) 
>                                                 for lorentz in aloha_info[0] ])
> @@ -1037,8 +1027,8 @@
>                 result = result+self.get_analytic_info('interaction_rank',
>                                                                      alohaModel)
>             else:
> -                raise MadGraph5Error, "A loop wavefunction has more than one loop"+\
> -                    " mothers."
> +                raise MadGraph5Error("A loop wavefunction has more than one loop"+\
> +                    " mothers.")
> 
>         # Now cache the resulting analytic info
>         self['analytic_info'][info] = result
> @@ -1134,8 +1124,7 @@
> 
>         # leg_state is final, unless there is exactly one initial 
>         # state particle involved in the combination -> t-channel
> -        if len(filter(lambda mother: mother.get('leg_state') == False,
> -                      self.get('mothers'))) == 1:
> +        if len([mother for mother in self.get('mothers') if mother.get('leg_state') == False]) == 1:
>             leg_state = False
>         else:
>             leg_state = True
> @@ -1362,9 +1351,7 @@
>             if flip_sign:
>                 # Flip state and particle identity
>                 # (to keep particle identity * flow state)
> -                new_wf.set('state', filter(lambda state: \
> -                                           state != new_wf.get('state'),
> -                                           ['incoming', 'outgoing'])[0])
> +                new_wf.set('state', list([state for state in ['incoming', 'outgoing'] if state != new_wf.get('state')])[0])
>                 new_wf.set('is_part', not new_wf.get('is_part'))
>             try:
>                 # Use the copy in wavefunctions instead.
> @@ -1386,7 +1373,7 @@
>                 # Need to replace wavefunction in number_to_wavefunctions
>                 # (in case this wavefunction is in another of the dicts) 
>                 for n_to_wf_dict in number_to_wavefunctions:
> -                    if new_wf in n_to_wf_dict.values():
> +                    if new_wf in list(n_to_wf_dict.values()):
>                         for key in n_to_wf_dict.keys():
>                             if n_to_wf_dict[key] == new_wf:
>                                 n_to_wf_dict[key] = new_wf          
> @@ -1443,7 +1430,7 @@
>         other_fermions = [wf for wf in self.get('mothers') if \
>                           wf.is_fermion() and wf != fermion_mother]
>         # Pick out bosons
> -        bosons = filter(lambda wf: wf.is_boson(), self.get('mothers'))
> +        bosons = [wf for wf in self.get('mothers') if wf.is_boson()]
> 
>         fermion_number_list = []
> 
> @@ -1489,8 +1476,7 @@
>         if name == 'is_part':
>             return not self.get('is_part')
>         if name == 'state':
> -            return filter(lambda state: state != self.get('state'),
> -                          ['incoming', 'outgoing'])[0]
> +            return list([state for state in ['incoming', 'outgoing'] if state != self.get('state')])[0]
>         return self.get(name)
> 
>     def get_external_helas_call_dict(self):
> @@ -1498,8 +1484,8 @@
>         helas call """
> 
>         if self['mothers']:
> -            raise MadGraph5Error, "This function should be called only for"+\
> -                                                    " external wavefunctions."
> +            raise MadGraph5Error("This function should be called only for"+\
> +                                                    " external wavefunctions.")
>         return_dict = {}
>         if self.get('is_loop'):
>             return_dict['conjugate'] = ('C' if self.needs_hermitian_conjugate() \
> @@ -1594,30 +1580,30 @@
>         if output['propa'] not in ['', None]:
>             output['propa'] = 'P%s' % output['propa']
>             if self.get('polarization'):
> -                raise InvalidCmd, 'particle with custom propagator can not have polarization'
> +                raise InvalidCmd( 'particle with custom propagator can not have polarization')
>         elif self.get('polarization'):
>             if self.get('polarization') == [0]:
>                 if self.get('spin') != 3:
> -                    raise InvalidCmd, 'polarization not handle for decay particle'
> +                    raise InvalidCmd( 'polarization not handle for decay particle')
>                 output['propa'] = 'P1L' 
>             elif self.get('polarization') == [1,-1]:
>                 if self.get('spin') != 3:
> -                    raise InvalidCmd, 'polarization not handle for decay particle'
> +                    raise InvalidCmd( 'polarization not handle for decay particle')
>                 output['propa'] = 'P1T'
>             elif self.get('polarization') == [99]:
>                 if self.get('spin') != 3:
> -                    raise InvalidCmd, 'polarization not handle for decay particle'
> +                    raise InvalidCmd('polarization not handle for decay particle')
>                 output['propa'] = 'P1A'
>             elif self.get('polarization') == [1]:
>                 if self.get('spin') != 2:
> -                    raise InvalidCmd, 'polarization not handle for decay particle'
> +                    raise InvalidCmd( 'polarization not handle for decay particle')
>                 output['propa'] = 'P1P'
>             elif self.get('polarization') == [-1]:
>                 if self.get('spin') != 2:
> -                    raise InvalidCmd, 'Left polarization not handle for decay particle for spin (2s+1=%s) particles' % self.get('spin') 
> +                    raise InvalidCmd( 'Left polarization not handle for decay particle for spin (2s+1=%s) particles' % self.get('spin')) 
>                 output['propa'] = 'P1M'
>             else:            
> -                raise InvalidCmd, 'polarization not handle for decay particle'
> +                raise InvalidCmd( 'polarization not handle for decay particle')
> 
>         # optimization
>         if aloha.complex_mass: 
> @@ -1823,7 +1809,7 @@
>         if self.get('interaction_id') in [0,-1]:
>             return None
> 
> -        tags = ['C%s' % w for w in self.get_conjugate_index()]
> +        tags = ['C%i' % w for w in self.get_conjugate_index()]
>         if self.get('is_loop'): 
>             if not optimized_output:
>                 tags.append('L')
> @@ -1844,7 +1830,7 @@
>             elif self.get('polarization') == [-1]:
>                 tags.append('P1M')
>             else:
> -                raise InvalidCmd, 'polarization not handle for decay particle'
> +                raise InvalidCmd( 'polarization not handle for decay particle')
> 
>         return (tuple(self.get('lorentz')),tuple(tags),self.find_outgoing_number())
> 
> @@ -1866,7 +1852,7 @@
>             if self.get('spin') == 3:
>                 return 'V'
>             else:
> -                raise MadGraph5Error,'L-cut particle type not supported'
> +                raise MadGraph5Error('L-cut particle type not supported')
>         else:
>             return ''
> 
> @@ -1887,15 +1873,13 @@
>         if reverse_t_ch: (startleg, finalleg) = (2,1)
> 
>         # Add vertices for all s-channel mothers
> -        final_mothers = filter(lambda wf: wf.get('number_external') > ninitial,
> -                               self.get('mothers'))
> +        final_mothers = [wf for wf in self.get('mothers') if wf.get('number_external') > ninitial]
> 
>         for mother in final_mothers:
>             schannels.extend(mother.get_base_vertices({}, optimization = 0))
> 
>         # Extract initial state mothers
> -        init_mothers = filter(lambda wf: wf.get('number_external') <= ninitial,
> -                              self.get('mothers'))
> +        init_mothers = [wf for wf in self.get('mothers') if wf.get('number_external') <= ninitial]
> 
>         assert len(init_mothers) < 3 , \
>                    "get_s_and_t_channels can only handle up to 2 initial states"
> @@ -2011,6 +1995,11 @@
>         schannels.sort(lambda x1,x2: x2.get('legs')[-1].get('number') - \
>                        x1.get('legs')[-1].get('number'))
> 
> +        for t in tchannels:
> +            t['is_t_channel'] = True
> +        for s in schannels:
> +            s['is_t_channel'] = False
> +            
>         return schannels, tchannels
> 
>     def get_struct_external_leg_ids(self):
> @@ -2038,8 +2027,8 @@
>             loop_wf_index=\
>                        [wf['is_loop'] for wf in self.get('mothers')].index(True)
>         except ValueError:
> -            raise MadGraph5Error, "The loop wavefunctions should have exactly"+\
> -                                                " one loop wavefunction mother."
> +            raise MadGraph5Error("The loop wavefunctions should have exactly"+\
> +                                                " one loop wavefunction mother.")
> 
>         if self.find_outgoing_number()-1<=loop_wf_index:
>             # If the incoming loop leg is placed after the outgoing one we
> @@ -2080,8 +2069,8 @@
>             if len(loop_wfs)==1:
>                 return loop_wfs[0]
>             else:
> -                raise MadGraph5Error, "The loop wavefunction must have either"+\
> -                  " no mothers, or exactly one mother with type 'loop'."
> +                raise MadGraph5Error("The loop wavefunction must have either"+\
> +                  " no mothers, or exactly one mother with type 'loop'.")
>         else:
>             return None
> 
> @@ -2459,11 +2448,10 @@
>             return True
> 
>         def RaiseError():
> -            raise self.PhysicsObjectListError, \
> -      "This wavefunction list does not have a consistent wavefunction ordering."+\
> +            raise self.PhysicsObjectListError("This wavefunction list does not have a consistent wavefunction ordering."+\
>       "\n  Wf numbers: %s"%str([wf['number'] for wf in diag_wfs])+\
>       "\n  Wf mothers: %s"%str([[mother['number'] for mother in wf['mothers']] \
> -                                                  for wf in diag_wfs])
> +                                                  for wf in diag_wfs]))
> 
>         # We want to work on a local copy of the wavefunction list attribute
>         diag_wfs = copy.copy(self)
> @@ -2578,106 +2566,86 @@
> 
>         if name == 'interaction_id':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer for interaction id" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer for interaction id" % \
> +                        str(value))
> 
>         if name == 'pdg_codes':
>             #Should be a list of integers
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of integers" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
>             for mystr in value:
>                 if not isinstance(mystr, int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(mystr)
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(mystr))
> 
>         if name == 'orders':
>             #Should be a dict with valid order names ask keys and int as values
>             if not isinstance(value, dict):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid dict for coupling orders" % \
> -                                                                    str(value)
> +                raise self.PhysicsObjectError("%s is not a valid dict for coupling orders" % \
> +                                                                    str(value))
>             for order in value.keys():
>                 if not isinstance(order, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid string" % str(order)
> +                    raise self.PhysicsObjectError("%s is not a valid string" % str(order))
>                 if not isinstance(value[order], int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(value[order])
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(value[order]))
> 
>         if name == 'inter_color':
>             # Should be None or a color string
>             if value and not isinstance(value, color.ColorString):
> -                    raise self.PhysicsObjectError, \
> -                            "%s is not a valid Color String" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid Color String" % str(value))
> 
>         if name == 'lorentz':
>             #Should be a list of string
>             if not isinstance(value, list):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of string" % str(value)
> +                    raise self.PhysicsObjectError("%s is not a valid list of string" % str(value))
>             for name in value:
>                 if not isinstance(name, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s doesn't contain only string" % str(value)
> +                    raise self.PhysicsObjectError("%s doesn't contain only string" % str(value))
> 
>         if name == 'coupling':
>             #Should be a list of string
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                      "%s is not a valid coupling (list of string)" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid coupling (list of string)" % str(value))
> 
>             for name in value:
>                 if not isinstance(name, str):
> -                    raise self.PhysicsObjectError, \
> -                        "%s doesn't contain only string" % str(value)
> +                    raise self.PhysicsObjectError("%s doesn't contain only string" % str(value))
>             if not len(value):
> -                raise self.PhysicsObjectError, \
> -                                      'coupling should have at least one value'
> +                raise self.PhysicsObjectError('coupling should have at least one value')
> 
>         if name == 'color_key':
>             if value and not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                      "%s is not a valid integer" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer" % str(value))
> 
>         if name == 'number':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer for amplitude number" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer for amplitude number" % \
> +                        str(value))
> 
>         if name == 'fermionfactor':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer for fermionfactor" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid integer for fermionfactor" % \
> +                        str(value))
>             if not value in [-1, 0, 1]:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid fermion factor (-1, 0 or 1)" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid fermion factor (-1, 0 or 1)" % \
> +                        str(value))
> 
>         if name == 'color_indices':
>             #Should be a list of integers
>             if not isinstance(value, list):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid list of integers" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of integers" % str(value))
>             for mystr in value:
>                 if not isinstance(mystr, int):
> -                    raise self.PhysicsObjectError, \
> -                        "%s is not a valid integer" % str(mystr)
> +                    raise self.PhysicsObjectError("%s is not a valid integer" % str(mystr))
> 
>         if name == 'mothers':
>             if not isinstance(value, HelasWavefunctionList):
> -                raise self.PhysicsObjectError, \
> -                      "%s is not a valid list of mothers for amplitude" % \
> -                      str(value)
> +                raise self.PhysicsObjectError("%s is not a valid list of mothers for amplitude" % \
> +                      str(value))
> 
>         if name == 'conjugate_indices':
>             if not isinstance(value, tuple) and value != None:
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid tuple" % str(value) + \
> -                        " for conjugate_indices"
> +                raise self.PhysicsObjectError("%s is not a valid tuple" % str(value) + \
> +                        " for conjugate_indices")
> 
>         return True
> 
> @@ -2786,11 +2754,10 @@
>                     if inter.get('lorentz'):
>                         self.set('lorentz', [inter.get('lorentz')[0]])
>                     if inter.get('couplings'):
> -                        self.set('coupling', [inter.get('couplings').values()[0]])
> +                        self.set('coupling', [list(inter.get('couplings').values())[0]])
>                 return True
>             else:
> -                raise self.PhysicsObjectError, \
> -                      "%s not allowed name for 3-argument set", name
> +                six.reraise(self.PhysicsObjectError( "%s not allowed name for 3-argument set", name))
>         else:
>             return super(HelasAmplitude, self).set(name, value)
> 
> @@ -2876,7 +2843,7 @@
> 
> 
>         # Pick out bosons
> -        bosons = filter(lambda wf: wf.is_boson(), self.get('mothers'))
> +        bosons = [wf for wf in self.get('mothers') if wf.is_boson()]
> 
>         fermion_number_list = []
> 
> @@ -3014,7 +2981,7 @@
>         if self.get('interaction_id') in [0,-1]:
>             return None
> 
> -        tags = ['C%s' % w for w in self.get_conjugate_index()]
> +        tags = ['C%i' % w for w in self.get_conjugate_index()]
> 
>         return (tuple(self.get('lorentz')),tuple(tags),self.find_outgoing_number())
> 
> @@ -3134,16 +3101,46 @@
> 
>         return tuple(sorted(indices))
> 
> +    def get_nb_t_channel(self):
> +        """ """
> +        
> +        def get_nb_t(wf):
> +            mothers = []
> +            try:
> +                mothers = wf.get('mothers')
> +            except: 
> +                return  0
> +            if not mothers:
> +                return 0
> +            nb_t = sum([get_nb_t(w) for w in mothers])
> +            try:
> +                if not wf.get('leg_state'):
> +                    return nb_t +1
> +            except Exception:
> +                return nb_t
> +            return nb_t
> +
> +        return get_nb_t(self)
> +        
> +        
> +    nbcall = 0 
>     def get_vertex_leg_numbers(self, 
>               veto_inter_id=base_objects.Vertex.ID_to_veto_for_multichanneling,
> -              max_n_loop=0):
> +                               max_n_loop=0, max_tpropa=0):
>         """Get a list of the number of legs in vertices in this diagram,
>         This function is only used for establishing the multi-channeling, so that
>         we exclude from it all the fake vertices and the vertices resulting from
>         shrunk loops (id=-2)"""
> 
> +        HelasAmplitude.nbcall +=1
>         if max_n_loop == 0:
>             max_n_loop = base_objects.Vertex.max_n_loop_for_multichanneling
> +        if max_tpropa == 0:
> +            try:
> +                max_tpropa = base_objects.Vertex.max_tpropa
> +            except AttributeError:
> +                max_tpropa = 99
> +
> 
>         vertex_leg_numbers = [len(self.get('mothers'))] if \
>                              (self['interaction_id'] not in veto_inter_id) or \
> @@ -3152,6 +3149,9 @@
>         for mother in self.get('mothers'):
>             vertex_leg_numbers.extend(mother.get_vertex_leg_numbers(
>                                                  veto_inter_id = veto_inter_id))
> +        nb_t = self.get_nb_t_channel()
> +        if nb_t > int(max_tpropa):
> +            return [] * len(vertex_leg_numbers)
> 
>         return vertex_leg_numbers
> 
> @@ -3277,15 +3277,13 @@
> 
>         if name == 'wavefunctions' or name == 'loop_wavefunctions':
>             if not isinstance(value, HelasWavefunctionList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid HelasWavefunctionList object" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid HelasWavefunctionList object" % \
> +                        str(value))
> 
>         if name == 'amplitudes':
>             if not isinstance(value, HelasAmplitudeList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid HelasAmplitudeList object" % \
> -                        str(value)
> +                raise self.PhysicsObjectError("%s is not a valid HelasAmplitudeList object" % \
> +                        str(value))
> 
>         return True
> 
> @@ -3322,6 +3320,11 @@
>         return self.get('amplitudes')[0].get_vertex_leg_numbers(
>                              veto_inter_id=veto_inter_id, max_n_loop=max_n_loop)
> 
> +    def get_nb_t_channel(self):
> +        """Get the number of T channel for this diagram"""
> +
> +        return self.get('amplitudes')[0].get_nb_t_channel()
> +
>     def get_regular_amplitudes(self):
>         """ For regular HelasDiagrams, it is simply all amplitudes.
>         It is overloaded in LoopHelasDiagram"""
> @@ -3385,33 +3388,26 @@
> 
>         if name == 'processes':
>             if not isinstance(value, base_objects.ProcessList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ProcessList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ProcessList object" % str(value))
>         if name == 'diagrams':
>             if not isinstance(value, HelasDiagramList):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid HelasDiagramList object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid HelasDiagramList object" % str(value))
>         if name == 'identical_particle_factor':
>             if not isinstance(value, int):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid int object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid int object" % str(value))
>         if name == 'color_basis':
>             if not isinstance(value, color_amp.ColorBasis):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ColorBasis object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ColorBasis object" % str(value))
>         if name == 'color_matrix':
>             if not isinstance(value, color_amp.ColorMatrix):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid ColorMatrix object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid ColorMatrix object" % str(value))
>         if name == 'base_amplitude':
>             if value != None and not \
>                    isinstance(value, diagram_generation.Amplitude):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid Amplitude object" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid Amplitude object" % str(value))
>         if name == 'has_mirror_process':
>             if not isinstance(value, bool):
> -                raise self.PhysicsObjectError, \
> -                        "%s is not a valid boolean" % str(value)
> +                raise self.PhysicsObjectError("%s is not a valid boolean" % str(value))
>         return True
> 
>     def get_sorted_keys(self):
> @@ -3647,7 +3643,7 @@
>                         try:
>                             wf = diagram_wavefunctions[\
>                                     diagram_wavefunctions.index(wf)]
> -                        except ValueError, error:
> +                        except ValueError as error:
>                             # Update wf number
>                             wf_number = wf_number + 1
>                             wf.set('number', wf_number)
> @@ -3714,7 +3710,7 @@
>                 done_color = {}
>                 for i, coupl_key in enumerate(keys):
>                     color = coupl_key[0]
> -                    if inter and color in done_color.keys():
> +                    if inter and color in list(done_color.keys()):
>                         amp = done_color[color]
>                         amp.get('coupling').append(inter.get('couplings')[coupl_key])
>                         amp.get('lorentz').append(inter.get('lorentz')[coupl_key[1]])
> @@ -3742,8 +3738,7 @@
> 
>             # After generation of all wavefunctions and amplitudes,
>             # first sort the wavefunctions according to number
> -            diagram_wavefunctions.sort(lambda wf1, wf2: \
> -                                       wf1.get('number') - wf2.get('number'))
> +            diagram_wavefunctions.sort(key=lambda wf:wf.get('number')) 
> 
>             # Then make sure that all mothers come before daughters
>             iwf = len(diagram_wavefunctions) - 1
> @@ -3807,7 +3802,7 @@
>                 pos+=1
>                 for wfin in wf.get('mothers'):
>                     last_lign[wfin.get('number')] = pos
> -                    assert wfin.get('number') in first.valu