https://launchpad.net/ubuntu/+source/ataqv/1.2.1+ds-1build1/+build/20400306 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux bos02-s390x-004 4.15.0-156-generic #163-Ubuntu SMP Thu Aug 19 23:28:47 UTC 2021 s390x Buildd toolchain package versions: launchpad-buildd_200~495~ubuntu18.04.1 python3-lpbuildd_200~495~ubuntu18.04.1 sbuild_0.75.0-1ubuntu1 bzr-builder_0.7.3+bzr174~ppa13~ubuntu16.04.1 bzr_2.7.0+bzr6622-10 git-build-recipe_0.3.6~git201906051340.ff11471~ubuntu18.04.1 git_1:2.17.1-1ubuntu0.8 dpkg-dev_1.19.0.5ubuntu2.3 python-debian_0.1.32 python3-debian_0.1.32. Syncing the system clock with the buildd NTP service... 10 Sep 18:10:24 ntpdate[1694]: adjust time server 10.211.37.1 offset 0.003605 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=hirsute --arch=s390x PACKAGEBUILD-20400306 --image-type chroot /home/buildd/filecache-default/b6a0d461e155d890cb32ede1aba203da854405ed Creating target for build PACKAGEBUILD-20400306 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=hirsute --arch=s390x PACKAGEBUILD-20400306 Starting target for build PACKAGEBUILD-20400306 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=hirsute --arch=s390x PACKAGEBUILD-20400306 'deb http://ftpmaster.internal/ubuntu hirsute main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-security main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-updates main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-20400306 RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=hirsute --arch=s390x PACKAGEBUILD-20400306 Updating target for build PACKAGEBUILD-20400306 Get:1 http://ftpmaster.internal/ubuntu hirsute InRelease [269 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute-security InRelease [110 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-updates InRelease [115 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-proposed InRelease [269 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute/main s390x Packages [1329 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main Translation-en [511 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/universe s390x Packages [12.4 MB] Get:8 http://ftpmaster.internal/ubuntu hirsute/universe Translation-en [5441 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute-security/main s390x Packages [171 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-security/main Translation-en [61.9 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-security/universe s390x Packages [166 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute-security/universe Translation-en [42.8 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x Packages [285 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute-updates/main Translation-en [95.8 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute-updates/universe s390x Packages [230 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute-updates/universe Translation-en [69.4 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x Packages [34.1 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute-proposed/main Translation-en [19.1 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute-proposed/universe s390x Packages [29.5 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute-proposed/universe Translation-en [24.3 kB] Fetched 21.7 MB in 4s (5188 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages will be upgraded: apt base-files base-passwd dpkg dpkg-dev gcc-11-base libapparmor1 libapt-pkg6.0 libasan6 libatomic1 libcc1-0 libdpkg-perl libgcc-s1 libgomp1 libhogweed6 libitm1 liblz4-1 libnettle8 libpam-modules libpam-modules-bin libpam-runtime libpam0g libperl5.32 libprocps8 libssl1.1 libstdc++6 libsystemd0 libubsan1 libudev1 linux-libc-dev login openssl passwd perl perl-base perl-modules-5.32 procps systemd systemd-sysv systemd-timesyncd 40 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 26.7 MB of archives. After this operation, 221 kB disk space will be freed. Get:1 http://ftpmaster.internal/ubuntu hirsute/main s390x base-files s390x 11ubuntu19 [60.3 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute/main s390x dpkg s390x 1.20.9ubuntu1 [1293 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x login s390x 1:4.8.1-1ubuntu8.1 [218 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libperl5.32 s390x 5.32.1-3ubuntu2.1 [3944 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute-security/main s390x perl s390x 5.32.1-3ubuntu2.1 [225 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute-security/main s390x perl-base s390x 5.32.1-3ubuntu2.1 [1612 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute-security/main s390x perl-modules-5.32 all 5.32.1-3ubuntu2.1 [2755 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x base-passwd s390x 3.5.49ubuntu1 [46.6 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libubsan1 s390x 11.1.0-1ubuntu1~21.04 [812 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libitm1 s390x 11.1.0-1ubuntu1~21.04 [25.6 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libgomp1 s390x 11.1.0-1ubuntu1~21.04 [99.4 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute-security/main s390x gcc-11-base s390x 11.1.0-1ubuntu1~21.04 [19.0 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libgcc-s1 s390x 11.1.0-1ubuntu1~21.04 [25.5 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libcc1-0 s390x 11.1.0-1ubuntu1~21.04 [46.2 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libatomic1 s390x 11.1.0-1ubuntu1~21.04 [8396 B] Get:16 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libasan6 s390x 11.1.0-1ubuntu1~21.04 [2020 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libstdc++6 s390x 11.1.0-1ubuntu1~21.04 [585 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute-security/main s390x liblz4-1 s390x 1.9.3-1ubuntu0.1 [56.0 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x systemd-timesyncd s390x 247.3-3ubuntu3.6 [27.0 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x systemd-sysv s390x 247.3-3ubuntu3.6 [10.3 kB] Get:21 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libapparmor1 s390x 3.0.0-0ubuntu7.1 [34.8 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libpam0g s390x 1.3.1-5ubuntu6.21.04.1 [55.7 kB] Get:23 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x systemd s390x 247.3-3ubuntu3.6 [4458 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x libsystemd0 s390x 247.3-3ubuntu3.6 [296 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x libudev1 s390x 247.3-3ubuntu3.6 [75.5 kB] Get:26 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libapt-pkg6.0 s390x 2.2.4ubuntu0.1 [764 kB] Get:27 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x apt s390x 2.2.4ubuntu0.1 [1280 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libpam-modules-bin s390x 1.3.1-5ubuntu6.21.04.1 [47.4 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libpam-modules s390x 1.3.1-5ubuntu6.21.04.1 [270 kB] Get:30 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libpam-runtime all 1.3.1-5ubuntu6.21.04.1 [37.3 kB] Get:31 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x passwd s390x 1:4.8.1-1ubuntu8.1 [799 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libnettle8 s390x 3.7-2.1ubuntu1.1 [156 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libhogweed6 s390x 3.7-2.1ubuntu1.1 [193 kB] Get:34 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libssl1.1 s390x 1.1.1j-1ubuntu3.5 [1083 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x libprocps8 s390x 2:3.3.16-5ubuntu3.1 [32.6 kB] Get:36 http://ftpmaster.internal/ubuntu hirsute-updates/main s390x procps s390x 2:3.3.16-5ubuntu3.1 [237 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute-security/main s390x openssl s390x 1.1.1j-1ubuntu3.5 [643 kB] Get:38 http://ftpmaster.internal/ubuntu hirsute/main s390x dpkg-dev all 1.20.9ubuntu1 [937 kB] Get:39 http://ftpmaster.internal/ubuntu hirsute/main s390x libdpkg-perl all 1.20.9ubuntu1 [232 kB] Get:40 http://ftpmaster.internal/ubuntu hirsute-proposed/main s390x linux-libc-dev s390x 5.11.0-35.37 [1228 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 26.7 MB in 2s (17.8 MB/s) (Reading database ... 12912 files and directories currently installed.) Preparing to unpack .../base-files_11ubuntu19_s390x.deb ... Unpacking base-files (11ubuntu19) over (11ubuntu18) ... Setting up base-files (11ubuntu19) ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... (Reading database ... 12912 files and directories currently installed.) Preparing to unpack .../dpkg_1.20.9ubuntu1_s390x.deb ... Unpacking dpkg (1.20.9ubuntu1) over (1.20.7.1ubuntu4) ... Setting up dpkg (1.20.9ubuntu1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../login_1%3a4.8.1-1ubuntu8.1_s390x.deb ... Unpacking login (1:4.8.1-1ubuntu8.1) over (1:4.8.1-1ubuntu8) ... Setting up login (1:4.8.1-1ubuntu8.1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../libperl5.32_5.32.1-3ubuntu2.1_s390x.deb ... Unpacking libperl5.32:s390x (5.32.1-3ubuntu2.1) over (5.32.1-3ubuntu2) ... Preparing to unpack .../perl_5.32.1-3ubuntu2.1_s390x.deb ... Unpacking perl (5.32.1-3ubuntu2.1) over (5.32.1-3ubuntu2) ... Preparing to unpack .../perl-base_5.32.1-3ubuntu2.1_s390x.deb ... Unpacking perl-base (5.32.1-3ubuntu2.1) over (5.32.1-3ubuntu2) ... Setting up perl-base (5.32.1-3ubuntu2.1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../perl-modules-5.32_5.32.1-3ubuntu2.1_all.deb ... Unpacking perl-modules-5.32 (5.32.1-3ubuntu2.1) over (5.32.1-3ubuntu2) ... Preparing to unpack .../base-passwd_3.5.49ubuntu1_s390x.deb ... Unpacking base-passwd (3.5.49ubuntu1) over (3.5.49) ... Setting up base-passwd (3.5.49ubuntu1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../libubsan1_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libubsan1:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libitm1_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libitm1:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libgomp1_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libgomp1:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../gcc-11-base_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking gcc-11-base:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Setting up gcc-11-base:s390x (11.1.0-1ubuntu1~21.04) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../libgcc-s1_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libgcc-s1:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Setting up libgcc-s1:s390x (11.1.0-1ubuntu1~21.04) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../libcc1-0_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libcc1-0:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libatomic1_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libatomic1:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libasan6_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libasan6:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libstdc++6_11.1.0-1ubuntu1~21.04_s390x.deb ... Unpacking libstdc++6:s390x (11.1.0-1ubuntu1~21.04) over (11-20210417-1ubuntu1) ... Setting up libstdc++6:s390x (11.1.0-1ubuntu1~21.04) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../liblz4-1_1.9.3-1ubuntu0.1_s390x.deb ... Unpacking liblz4-1:s390x (1.9.3-1ubuntu0.1) over (1.9.3-1build1) ... Setting up liblz4-1:s390x (1.9.3-1ubuntu0.1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../systemd-timesyncd_247.3-3ubuntu3.6_s390x.deb ... Unpacking systemd-timesyncd (247.3-3ubuntu3.6) over (247.3-3ubuntu3) ... Preparing to unpack .../systemd-sysv_247.3-3ubuntu3.6_s390x.deb ... Unpacking systemd-sysv (247.3-3ubuntu3.6) over (247.3-3ubuntu3) ... Preparing to unpack .../libapparmor1_3.0.0-0ubuntu7.1_s390x.deb ... Unpacking libapparmor1:s390x (3.0.0-0ubuntu7.1) over (3.0.0-0ubuntu7) ... Preparing to unpack .../libpam0g_1.3.1-5ubuntu6.21.04.1_s390x.deb ... Unpacking libpam0g:s390x (1.3.1-5ubuntu6.21.04.1) over (1.3.1-5ubuntu6) ... Setting up libpam0g:s390x (1.3.1-5ubuntu6.21.04.1) ... (Reading database ... 12917 files and directories currently installed.) Preparing to unpack .../systemd_247.3-3ubuntu3.6_s390x.deb ... Unpacking systemd (247.3-3ubuntu3.6) over (247.3-3ubuntu3) ... Preparing to unpack .../libsystemd0_247.3-3ubuntu3.6_s390x.deb ... Unpacking libsystemd0:s390x (247.3-3ubuntu3.6) over (247.3-3ubuntu3) ... Setting up libsystemd0:s390x (247.3-3ubuntu3.6) ... (Reading database ... 12918 files and directories currently installed.) Preparing to unpack .../libudev1_247.3-3ubuntu3.6_s390x.deb ... Unpacking libudev1:s390x (247.3-3ubuntu3.6) over (247.3-3ubuntu3) ... Setting up libudev1:s390x (247.3-3ubuntu3.6) ... (Reading database ... 12918 files and directories currently installed.) Preparing to unpack .../libapt-pkg6.0_2.2.4ubuntu0.1_s390x.deb ... Unpacking libapt-pkg6.0:s390x (2.2.4ubuntu0.1) over (2.2.3) ... Setting up libapt-pkg6.0:s390x (2.2.4ubuntu0.1) ... (Reading database ... 12918 files and directories currently installed.) Preparing to unpack .../apt_2.2.4ubuntu0.1_s390x.deb ... Unpacking apt (2.2.4ubuntu0.1) over (2.2.3) ... Setting up apt (2.2.4ubuntu0.1) ... (Reading database ... 12918 files and directories currently installed.) Preparing to unpack .../libpam-modules-bin_1.3.1-5ubuntu6.21.04.1_s390x.deb ... Unpacking libpam-modules-bin (1.3.1-5ubuntu6.21.04.1) over (1.3.1-5ubuntu6) ... Setting up libpam-modules-bin (1.3.1-5ubuntu6.21.04.1) ... (Reading database ... 12920 files and directories currently installed.) Preparing to unpack .../libpam-modules_1.3.1-5ubuntu6.21.04.1_s390x.deb ... Unpacking libpam-modules:s390x (1.3.1-5ubuntu6.21.04.1) over (1.3.1-5ubuntu6) ... Setting up libpam-modules:s390x (1.3.1-5ubuntu6.21.04.1) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../libpam-runtime_1.3.1-5ubuntu6.21.04.1_all.deb ... Unpacking libpam-runtime (1.3.1-5ubuntu6.21.04.1) over (1.3.1-5ubuntu6) ... Setting up libpam-runtime (1.3.1-5ubuntu6.21.04.1) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../passwd_1%3a4.8.1-1ubuntu8.1_s390x.deb ... Unpacking passwd (1:4.8.1-1ubuntu8.1) over (1:4.8.1-1ubuntu8) ... Setting up passwd (1:4.8.1-1ubuntu8.1) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../libnettle8_3.7-2.1ubuntu1.1_s390x.deb ... Unpacking libnettle8:s390x (3.7-2.1ubuntu1.1) over (3.7-2.1ubuntu1) ... Setting up libnettle8:s390x (3.7-2.1ubuntu1.1) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../libhogweed6_3.7-2.1ubuntu1.1_s390x.deb ... Unpacking libhogweed6:s390x (3.7-2.1ubuntu1.1) over (3.7-2.1ubuntu1) ... Setting up libhogweed6:s390x (3.7-2.1ubuntu1.1) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../libssl1.1_1.1.1j-1ubuntu3.5_s390x.deb ... Unpacking libssl1.1:s390x (1.1.1j-1ubuntu3.5) over (1.1.1j-1ubuntu3) ... Setting up libssl1.1:s390x (1.1.1j-1ubuntu3.5) ... (Reading database ... 12924 files and directories currently installed.) Preparing to unpack .../0-libprocps8_2%3a3.3.16-5ubuntu3.1_s390x.deb ... Unpacking libprocps8:s390x (2:3.3.16-5ubuntu3.1) over (2:3.3.16-5ubuntu3) ... Preparing to unpack .../1-procps_2%3a3.3.16-5ubuntu3.1_s390x.deb ... Unpacking procps (2:3.3.16-5ubuntu3.1) over (2:3.3.16-5ubuntu3) ... Preparing to unpack .../2-openssl_1.1.1j-1ubuntu3.5_s390x.deb ... Unpacking openssl (1.1.1j-1ubuntu3.5) over (1.1.1j-1ubuntu3) ... Preparing to unpack .../3-dpkg-dev_1.20.9ubuntu1_all.deb ... Unpacking dpkg-dev (1.20.9ubuntu1) over (1.20.7.1ubuntu4) ... Preparing to unpack .../4-libdpkg-perl_1.20.9ubuntu1_all.deb ... Unpacking libdpkg-perl (1.20.9ubuntu1) over (1.20.7.1ubuntu4) ... Preparing to unpack .../5-linux-libc-dev_5.11.0-35.37_s390x.deb ... Unpacking linux-libc-dev:s390x (5.11.0-35.37) over (5.11.0-14.15) ... Setting up libapparmor1:s390x (3.0.0-0ubuntu7.1) ... Setting up perl-modules-5.32 (5.32.1-3ubuntu2.1) ... Setting up linux-libc-dev:s390x (5.11.0-35.37) ... Setting up libgomp1:s390x (11.1.0-1ubuntu1~21.04) ... Setting up libasan6:s390x (11.1.0-1ubuntu1~21.04) ... Setting up libatomic1:s390x (11.1.0-1ubuntu1~21.04) ... Setting up libperl5.32:s390x (5.32.1-3ubuntu2.1) ... Setting up libubsan1:s390x (11.1.0-1ubuntu1~21.04) ... Setting up openssl (1.1.1j-1ubuntu3.5) ... Setting up libcc1-0:s390x (11.1.0-1ubuntu1~21.04) ... Setting up libprocps8:s390x (2:3.3.16-5ubuntu3.1) ... Setting up libitm1:s390x (11.1.0-1ubuntu1~21.04) ... Setting up perl (5.32.1-3ubuntu2.1) ... Setting up libdpkg-perl (1.20.9ubuntu1) ... Setting up procps (2:3.3.16-5ubuntu3.1) ... Setting up dpkg-dev (1.20.9ubuntu1) ... Setting up systemd (247.3-3ubuntu3.6) ... Initializing machine ID from random generator. Setting up systemd-timesyncd (247.3-3ubuntu3.6) ... Setting up systemd-sysv (247.3-3ubuntu3.6) ... Processing triggers for libc-bin (2.33-0ubuntu5) ... RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-20400306 s390x hirsute-proposed -c chroot:build-PACKAGEBUILD-20400306 --arch=s390x --dist=hirsute-proposed --nolog ataqv_1.2.1+ds-1build1.dsc Initiating build PACKAGEBUILD-20400306 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 4.15.0-156-generic #163-Ubuntu SMP Thu Aug 19 23:28:47 UTC 2021 s390x sbuild (Debian sbuild) 0.75.0 (21 Mar 2018) on bos02-s390x-004.buildd +==============================================================================+ | ataqv 1.2.1+ds-1build1 (s390x) Fri, 10 Sep 2021 18:10:42 +0000 | +==============================================================================+ Package: ataqv Version: 1.2.1+ds-1build1 Source Version: 1.2.1+ds-1build1 Distribution: hirsute-proposed Machine Architecture: s390x Host Architecture: s390x Build Architecture: s390x Build Type: any I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-20400306/chroot-autobuild' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- ataqv_1.2.1+ds-1build1.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/ataqv-jjQmSF/ataqv-1.2.1+ds' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-jjQmSF' with '<>' +------------------------------------------------------------------------------+ | Install build-essential | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<>/resolver-beDiKf/apt_archive/sbuild-build-depends-core-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 1 entries to output Packages file. Ign:1 copy:/<>/resolver-beDiKf/apt_archive ./ InRelease Get:2 copy:/<>/resolver-beDiKf/apt_archive ./ Release [957 B] Ign:3 copy:/<>/resolver-beDiKf/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-beDiKf/apt_archive ./ Sources [349 B] Get:5 copy:/<>/resolver-beDiKf/apt_archive ./ Packages [433 B] Fetched 1739 B in 0s (118 kB/s) Reading package lists... Reading package lists... Install core build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 852 B of archives. After this operation, 0 B of additional disk space will be used. Get:1 copy:/<>/resolver-beDiKf/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [852 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 852 B in 0s (0 B/s) Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... 12926 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_s390x.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (s390x included in any) +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 dpkg-deb: building package 'sbuild-build-depends-ataqv-dummy' in '/<>/resolver-beDiKf/apt_archive/sbuild-build-depends-ataqv-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-ataqv-dummy sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 2 entries to output Packages file. Ign:1 copy:/<>/resolver-beDiKf/apt_archive ./ InRelease Get:2 copy:/<>/resolver-beDiKf/apt_archive ./ Release [963 B] Ign:3 copy:/<>/resolver-beDiKf/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-beDiKf/apt_archive ./ Sources [615 B] Get:5 copy:/<>/resolver-beDiKf/apt_archive ./ Packages [696 B] Fetched 2274 B in 0s (0 B/s) Reading package lists... Reading package lists... Install ataqv build dependencies (apt-based resolver) ----------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libasn1-8-heimdal libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libgssapi3-heimdal libhcrypto4-heimdal libheimbase1-heimdal libheimntlm0-heimdal libhts-dev libhts3 libhx509-5-heimdal libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libkrb5-26-heimdal libldap-2.4-2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libmpdec3 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 libpython3-stdlib libpython3.9-minimal libpython3.9-stdlib libroken18-heimdal librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libwind0-heimdal libxml2 m4 man-db media-types node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv node-normalize.css node-rw nodejs po-debconf python3 python3-minimal python3.9 python3.9-minimal zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libboost1.74-doc libboost-atomic1.74-dev libboost-container1.74-dev libboost-context1.74-dev libboost-contract1.74-dev libboost-coroutine1.74-dev libboost-date-time1.74-dev libboost-exception1.74-dev libboost-fiber1.74-dev libboost-graph1.74-dev libboost-graph-parallel1.74-dev libboost-locale1.74-dev libboost-log1.74-dev libboost-math1.74-dev libboost-mpi1.74-dev libboost-mpi-python1.74-dev libboost-numpy1.74-dev libboost-program-options1.74-dev libboost-python1.74-dev libboost-random1.74-dev libboost-serialization1.74-dev libboost-stacktrace1.74-dev libboost-test1.74-dev libboost-thread1.74-dev libboost-timer1.74-dev libboost-type-erasure1.74-dev libboost-wave1.74-dev libboost1.74-tools-dev libmpfrc++-dev libntl-dev libboost-nowide1.74-dev libcurl4-doc libgnutls28-dev libidn11-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libjs-html5shiv npm libmail-box-perl python3-doc python3-tk python3-venv python3.9-venv python3.9-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl javascript-common libldap-common publicsuffix libsasl2-modules libltdl-dev nodejs-doc libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libasn1-8-heimdal libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libgssapi3-heimdal libhcrypto4-heimdal libheimbase1-heimdal libheimntlm0-heimdal libhts-dev libhts3 libhx509-5-heimdal libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libkrb5-26-heimdal libldap-2.4-2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libmpdec3 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 libpython3-stdlib libpython3.9-minimal libpython3.9-stdlib libroken18-heimdal librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libwind0-heimdal libxml2 m4 man-db media-types node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv node-normalize.css node-rw nodejs po-debconf python3 python3-minimal python3.9 python3.9-minimal sbuild-build-depends-ataqv-dummy zlib1g-dev 0 upgraded, 134 newly installed, 0 to remove and 0 not upgraded. Need to get 61.9 MB of archives. After this operation, 375 MB of additional disk space will be used. Get:1 copy:/<>/resolver-beDiKf/apt_archive ./ sbuild-build-depends-ataqv-dummy 0.invalid.0 [988 B] Get:2 http://ftpmaster.internal/ubuntu hirsute/main s390x liblocale-gettext-perl s390x 1.07-4build1 [16.4 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libpython3.9-minimal s390x 3.9.5-3~21.04 [751 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute/main s390x libexpat1 s390x 2.2.10-2 [86.8 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute-security/main s390x python3.9-minimal s390x 3.9.5-3~21.04 [1892 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main s390x python3-minimal s390x 3.9.4-1 [23.8 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/main s390x media-types all 4.0.0 [22.2 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute/main s390x libmpdec3 s390x 2.5.1-2 [84.5 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libpython3.9-stdlib s390x 3.9.5-3~21.04 [1652 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-security/main s390x python3.9 s390x 3.9.5-3~21.04 [423 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute/main s390x libpython3-stdlib s390x 3.9.4-1 [6984 B] Get:12 http://ftpmaster.internal/ubuntu hirsute/main s390x python3 s390x 3.9.4-1 [22.2 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute/main s390x bsdextrautils s390x 2.36.1-7ubuntu2 [81.5 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute/main s390x libuchardet0 s390x 0.0.7-1 [67.5 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute/main s390x groff-base s390x 1.22.4-6 [912 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute/main s390x libpipeline1 s390x 1.5.3-1 [28.7 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute/main s390x man-db s390x 2.9.4-2 [1168 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-normalize.css all 8.0.1-3 [10.3 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute/main s390x libelf1 s390x 0.183-8 [54.7 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute/main s390x libicu67 s390x 67.1-6ubuntu2 [8483 kB] Get:21 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libxml2 s390x 2.9.10+dfsg-6.3ubuntu0.1 [616 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute/main s390x libmagic-mgc s390x 1:5.39-3 [229 kB] Get:23 http://ftpmaster.internal/ubuntu hirsute/main s390x libmagic1 s390x 1:5.39-3 [83.6 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute/main s390x file s390x 1:5.39-3 [24.0 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute/main s390x gettext-base s390x 0.21-3ubuntu2 [41.0 kB] Get:26 http://ftpmaster.internal/ubuntu hirsute/main s390x libpsl5 s390x 0.21.0-1.2 [53.7 kB] Get:27 http://ftpmaster.internal/ubuntu hirsute/main s390x libsigsegv2 s390x 2.13-1ubuntu1 [14.2 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute/main s390x m4 s390x 1.4.18-5 [209 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute/main s390x autoconf all 2.69-14 [293 kB] Get:30 http://ftpmaster.internal/ubuntu hirsute/main s390x autotools-dev all 20180224.1+nmu1 [39.4 kB] Get:31 http://ftpmaster.internal/ubuntu hirsute/main s390x automake all 1:1.16.3-2ubuntu1 [552 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute/main s390x autopoint all 0.21-3ubuntu2 [422 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute/main s390x libdebhelper-perl all 13.3.4ubuntu1 [61.1 kB] Get:34 http://ftpmaster.internal/ubuntu hirsute/main s390x libtool all 2.4.6-15 [161 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute/main s390x dh-autoreconf all 20 [16.1 kB] Get:36 http://ftpmaster.internal/ubuntu hirsute/main s390x libarchive-zip-perl all 1.68-1 [90.2 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute/main s390x libsub-override-perl all 0.09-2 [9532 B] Get:38 http://ftpmaster.internal/ubuntu hirsute/main s390x libfile-stripnondeterminism-perl all 1.11.0-1 [17.0 kB] Get:39 http://ftpmaster.internal/ubuntu hirsute/main s390x dh-strip-nondeterminism all 1.11.0-1 [5236 B] Get:40 http://ftpmaster.internal/ubuntu hirsute/main s390x libdw1 s390x 0.183-8 [218 kB] Get:41 http://ftpmaster.internal/ubuntu hirsute/main s390x debugedit s390x 1:0.1-0ubuntu2 [40.3 kB] Get:42 http://ftpmaster.internal/ubuntu hirsute/main s390x dwz s390x 0.14-1 [110 kB] Get:43 http://ftpmaster.internal/ubuntu hirsute/main s390x gettext s390x 0.21-3ubuntu2 [869 kB] Get:44 http://ftpmaster.internal/ubuntu hirsute/main s390x intltool-debian all 0.35.0+20060710.5 [24.9 kB] Get:45 http://ftpmaster.internal/ubuntu hirsute/main s390x po-debconf all 1.0.21+nmu1 [233 kB] Get:46 http://ftpmaster.internal/ubuntu hirsute/main s390x debhelper all 13.3.4ubuntu1 [920 kB] Get:47 http://ftpmaster.internal/ubuntu hirsute/main s390x fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4 [515 kB] Get:48 http://ftpmaster.internal/ubuntu hirsute/universe s390x help2man s390x 1.48.1 [182 kB] Get:49 http://ftpmaster.internal/ubuntu hirsute/main s390x icu-devtools s390x 67.1-6ubuntu2 [184 kB] Get:50 http://ftpmaster.internal/ubuntu hirsute/main s390x libroken18-heimdal s390x 7.7.0+dfsg-2 [40.0 kB] Get:51 http://ftpmaster.internal/ubuntu hirsute/main s390x libasn1-8-heimdal s390x 7.7.0+dfsg-2 [148 kB] Get:52 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost1.74-dev s390x 1.74.0-8ubuntu2 [9509 kB] Get:53 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-chrono1.74.0 s390x 1.74.0-8ubuntu2 [225 kB] Get:54 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-chrono1.74-dev s390x 1.74.0-8ubuntu2 [229 kB] Get:55 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-chrono-dev s390x 1.74.0.3ubuntu5 [3964 B] Get:56 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-filesystem1.74.0 s390x 1.74.0-8ubuntu2 [253 kB] Get:57 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-system1.74.0 s390x 1.74.0-8ubuntu2 [215 kB] Get:58 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-system1.74-dev s390x 1.74.0-8ubuntu2 [213 kB] Get:59 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-filesystem1.74-dev s390x 1.74.0-8ubuntu2 [278 kB] Get:60 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-filesystem-dev s390x 1.74.0.3ubuntu5 [3368 B] Get:61 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-regex1.74.0 s390x 1.74.0-8ubuntu2 [467 kB] Get:62 http://ftpmaster.internal/ubuntu hirsute/main s390x libicu-dev s390x 67.1-6ubuntu2 [9687 kB] Get:63 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-regex1.74-dev s390x 1.74.0-8ubuntu2 [536 kB] Get:64 http://ftpmaster.internal/ubuntu hirsute/main s390x libboost-iostreams1.74.0 s390x 1.74.0-8ubuntu2 [237 kB] Get:65 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-iostreams1.74-dev s390x 1.74.0-8ubuntu2 [243 kB] Get:66 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-iostreams-dev s390x 1.74.0.3ubuntu5 [3320 B] Get:67 http://ftpmaster.internal/ubuntu hirsute/universe s390x libboost-system-dev s390x 1.74.0.3ubuntu5 [3484 B] Get:68 http://ftpmaster.internal/ubuntu hirsute/main s390x libbrotli1 s390x 1.0.9-2build2 [271 kB] Get:69 http://ftpmaster.internal/ubuntu hirsute/main s390x libheimbase1-heimdal s390x 7.7.0+dfsg-2 [27.7 kB] Get:70 http://ftpmaster.internal/ubuntu hirsute/main s390x libhcrypto4-heimdal s390x 7.7.0+dfsg-2 [83.1 kB] Get:71 http://ftpmaster.internal/ubuntu hirsute/main s390x libwind0-heimdal s390x 7.7.0+dfsg-2 [47.7 kB] Get:72 http://ftpmaster.internal/ubuntu hirsute/main s390x libhx509-5-heimdal s390x 7.7.0+dfsg-2 [97.9 kB] Get:73 http://ftpmaster.internal/ubuntu hirsute/main s390x libkrb5-26-heimdal s390x 7.7.0+dfsg-2 [191 kB] Get:74 http://ftpmaster.internal/ubuntu hirsute/main s390x libheimntlm0-heimdal s390x 7.7.0+dfsg-2 [14.4 kB] Get:75 http://ftpmaster.internal/ubuntu hirsute/main s390x libgssapi3-heimdal s390x 7.7.0+dfsg-2 [87.2 kB] Get:76 http://ftpmaster.internal/ubuntu hirsute/main s390x libsasl2-modules-db s390x 2.1.27+dfsg-2ubuntu1 [14.5 kB] Get:77 http://ftpmaster.internal/ubuntu hirsute/main s390x libsasl2-2 s390x 2.1.27+dfsg-2ubuntu1 [48.8 kB] Get:78 http://ftpmaster.internal/ubuntu hirsute/main s390x libldap-2.4-2 s390x 2.4.57+dfsg-2ubuntu1 [157 kB] Get:79 http://ftpmaster.internal/ubuntu hirsute/main s390x libnghttp2-14 s390x 1.43.0-1 [77.6 kB] Get:80 http://ftpmaster.internal/ubuntu hirsute/main s390x librtmp1 s390x 2.4+20151223.gitfa8646d.1-2build2 [50.7 kB] Get:81 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libssh-4 s390x 0.9.5-1ubuntu0.1 [174 kB] Get:82 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libcurl3-gnutls s390x 7.74.0-1ubuntu2.1 [275 kB] Get:83 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libcurl4-gnutls-dev s390x 7.74.0-1ubuntu2.1 [350 kB] Get:84 http://ftpmaster.internal/ubuntu hirsute/main s390x libdeflate0 s390x 1.7-1ubuntu1 [63.9 kB] Get:85 http://ftpmaster.internal/ubuntu hirsute/main s390x libdeflate-dev s390x 1.7-1ubuntu1 [45.0 kB] Get:86 http://ftpmaster.internal/ubuntu hirsute/universe s390x libhts3 s390x 1.11-4 [355 kB] Get:87 http://ftpmaster.internal/ubuntu hirsute/main s390x liblzma-dev s390x 5.2.5-1.0build2 [156 kB] Get:88 http://ftpmaster.internal/ubuntu hirsute/main s390x zlib1g-dev s390x 1:1.2.11.dfsg-2ubuntu6 [165 kB] Get:89 http://ftpmaster.internal/ubuntu hirsute/universe s390x libhts-dev s390x 1.11-4 [3937 kB] Get:90 http://ftpmaster.internal/ubuntu hirsute/main s390x libjs-jquery all 3.5.1+dfsg+~3.5.5-7 [314 kB] Get:91 http://ftpmaster.internal/ubuntu hirsute/universe s390x libjs-jquery-datatables all 1.10.21+dfsg-1 [137 kB] Get:92 http://ftpmaster.internal/ubuntu hirsute/universe s390x libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-4 [648 kB] Get:93 http://ftpmaster.internal/ubuntu hirsute/main s390x libncurses-dev s390x 6.2+20201114-2build1 [380 kB] Get:94 http://ftpmaster.internal/ubuntu hirsute/main s390x libncurses5-dev s390x 6.2+20201114-2build1 [996 B] Get:95 http://ftpmaster.internal/ubuntu hirsute-security/main s390x libc-ares2 s390x 1.17.1-1ubuntu0.1 [44.4 kB] Get:96 http://ftpmaster.internal/ubuntu hirsute/universe s390x libnode72 s390x 12.21.0~dfsg-3ubuntu1 [7888 kB] Get:97 http://ftpmaster.internal/ubuntu hirsute/universe s390x nodejs s390x 12.21.0~dfsg-3ubuntu1 [119 kB] Get:98 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-array all 1.2.4-3 [19.2 kB] Get:99 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-axis all 1.0.12-3 [10.2 kB] Get:100 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-dispatch all 1.0.6-2 [7896 B] Get:101 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-selection all 1.4.0-6 [30.8 kB] Get:102 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-drag all 1.2.5-2 [13.9 kB] Get:103 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-color all 1.2.8-2 [15.1 kB] Get:104 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-interpolate all 1.4.0-2 [18.5 kB] Get:105 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-ease all 1.0.5-3 [9972 B] Get:106 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-timer all 1.0.10-1 [8652 B] Get:107 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-transition all 1.3.2-3 [22.2 kB] Get:108 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-brush all 1.1.5-2 [177 kB] Get:109 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-path all 1.0.9-2 [8256 B] Get:110 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-chord all 1.0.6-3 [10.1 kB] Get:111 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-collection all 1.0.7-3 [11.8 kB] Get:112 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-contour all 1.3.2-4 [13.7 kB] Get:113 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-iconv s390x 2.3.5-5 [116 kB] Get:114 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-queue all 3.0.7-11 [9868 B] Get:115 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-rw all 1.3.3-2 [7136 B] Get:116 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-commander all 6.2.1-2 [32.7 kB] Get:117 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-dsv all 1.1.1-3 [14.3 kB] Get:118 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-fetch all 1.2.0-1 [7384 B] Get:119 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-quadtree all 1.0.7-2 [13.1 kB] Get:120 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-force all 1.2.1-2 [363 kB] Get:121 http://ftpmaster.internal/ubuntu hirsute/universe s390x libjs-d3-format all 1:1.4.1-3 [17.0 kB] Get:122 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-format all 1:1.4.1-3 [7592 B] Get:123 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-geo all 1.11.9-4 [53.6 kB] Get:124 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-hierarchy all 1.1.8-3 [28.6 kB] Get:125 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-polygon all 1.0.5-3 [7432 B] Get:126 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-random all 1.1.2-3 [7224 B] Get:127 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-time all 1.0.11-4 [14.6 kB] Get:128 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-time-format all 2.1.3-3 [18.9 kB] Get:129 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-scale all 2.2.2-3 [31.4 kB] Get:130 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-scale-chromatic all 1.5.0-2 [18.5 kB] Get:131 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-shape all 1.3.7-2 [40.5 kB] Get:132 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-voronoi all 1.1.4-3 [17.2 kB] Get:133 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3-zoom all 1.8.3-2 [20.2 kB] Get:134 http://ftpmaster.internal/ubuntu hirsute/universe s390x node-d3 all 5.16.0-4 [171 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 61.9 MB in 6s (11.2 MB/s) Selecting previously unselected package liblocale-gettext-perl. (Reading database ... 12926 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-4build1_s390x.deb ... Unpacking liblocale-gettext-perl (1.07-4build1) ... Selecting previously unselected package libpython3.9-minimal:s390x. Preparing to unpack .../libpython3.9-minimal_3.9.5-3~21.04_s390x.deb ... Unpacking libpython3.9-minimal:s390x (3.9.5-3~21.04) ... Selecting previously unselected package libexpat1:s390x. Preparing to unpack .../libexpat1_2.2.10-2_s390x.deb ... Unpacking libexpat1:s390x (2.2.10-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../python3.9-minimal_3.9.5-3~21.04_s390x.deb ... Unpacking python3.9-minimal (3.9.5-3~21.04) ... Setting up libpython3.9-minimal:s390x (3.9.5-3~21.04) ... Setting up libexpat1:s390x (2.2.10-2) ... Setting up python3.9-minimal (3.9.5-3~21.04) ... Selecting previously unselected package python3-minimal. (Reading database ... 13233 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.4-1_s390x.deb ... Unpacking python3-minimal (3.9.4-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:s390x. Preparing to unpack .../2-libmpdec3_2.5.1-2_s390x.deb ... Unpacking libmpdec3:s390x (2.5.1-2) ... Selecting previously unselected package libpython3.9-stdlib:s390x. Preparing to unpack .../3-libpython3.9-stdlib_3.9.5-3~21.04_s390x.deb ... Unpacking libpython3.9-stdlib:s390x (3.9.5-3~21.04) ... Selecting previously unselected package python3.9. Preparing to unpack .../4-python3.9_3.9.5-3~21.04_s390x.deb ... Unpacking python3.9 (3.9.5-3~21.04) ... Selecting previously unselected package libpython3-stdlib:s390x. Preparing to unpack .../5-libpython3-stdlib_3.9.4-1_s390x.deb ... Unpacking libpython3-stdlib:s390x (3.9.4-1) ... Setting up python3-minimal (3.9.4-1) ... Selecting previously unselected package python3. (Reading database ... 13629 files and directories currently installed.) Preparing to unpack .../000-python3_3.9.4-1_s390x.deb ... Unpacking python3 (3.9.4-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../001-bsdextrautils_2.36.1-7ubuntu2_s390x.deb ... Unpacking bsdextrautils (2.36.1-7ubuntu2) ... Selecting previously unselected package libuchardet0:s390x. Preparing to unpack .../002-libuchardet0_0.0.7-1_s390x.deb ... Unpacking libuchardet0:s390x (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../003-groff-base_1.22.4-6_s390x.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:s390x. Preparing to unpack .../004-libpipeline1_1.5.3-1_s390x.deb ... Unpacking libpipeline1:s390x (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../005-man-db_2.9.4-2_s390x.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../006-node-normalize.css_8.0.1-3_all.deb ... Unpacking node-normalize.css (8.0.1-3) ... Selecting previously unselected package libelf1:s390x. Preparing to unpack .../007-libelf1_0.183-8_s390x.deb ... Unpacking libelf1:s390x (0.183-8) ... Selecting previously unselected package libicu67:s390x. Preparing to unpack .../008-libicu67_67.1-6ubuntu2_s390x.deb ... Unpacking libicu67:s390x (67.1-6ubuntu2) ... Selecting previously unselected package libxml2:s390x. Preparing to unpack .../009-libxml2_2.9.10+dfsg-6.3ubuntu0.1_s390x.deb ... Unpacking libxml2:s390x (2.9.10+dfsg-6.3ubuntu0.1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../010-libmagic-mgc_1%3a5.39-3_s390x.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:s390x. Preparing to unpack .../011-libmagic1_1%3a5.39-3_s390x.deb ... Unpacking libmagic1:s390x (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../012-file_1%3a5.39-3_s390x.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../013-gettext-base_0.21-3ubuntu2_s390x.deb ... Unpacking gettext-base (0.21-3ubuntu2) ... Selecting previously unselected package libpsl5:s390x. Preparing to unpack .../014-libpsl5_0.21.0-1.2_s390x.deb ... Unpacking libpsl5:s390x (0.21.0-1.2) ... Selecting previously unselected package libsigsegv2:s390x. Preparing to unpack .../015-libsigsegv2_2.13-1ubuntu1_s390x.deb ... Unpacking libsigsegv2:s390x (2.13-1ubuntu1) ... Selecting previously unselected package m4. Preparing to unpack .../016-m4_1.4.18-5_s390x.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../017-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../018-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../019-automake_1%3a1.16.3-2ubuntu1_all.deb ... Unpacking automake (1:1.16.3-2ubuntu1) ... Selecting previously unselected package autopoint. Preparing to unpack .../020-autopoint_0.21-3ubuntu2_all.deb ... Unpacking autopoint (0.21-3ubuntu2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../021-libdebhelper-perl_13.3.4ubuntu1_all.deb ... Unpacking libdebhelper-perl (13.3.4ubuntu1) ... Selecting previously unselected package libtool. Preparing to unpack .../022-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../023-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../024-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../025-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../026-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../027-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libdw1:s390x. Preparing to unpack .../028-libdw1_0.183-8_s390x.deb ... Unpacking libdw1:s390x (0.183-8) ... Selecting previously unselected package debugedit. Preparing to unpack .../029-debugedit_1%3a0.1-0ubuntu2_s390x.deb ... Unpacking debugedit (1:0.1-0ubuntu2) ... Selecting previously unselected package dwz. Preparing to unpack .../030-dwz_0.14-1_s390x.deb ... Unpacking dwz (0.14-1) ... Selecting previously unselected package gettext. Preparing to unpack .../031-gettext_0.21-3ubuntu2_s390x.deb ... Unpacking gettext (0.21-3ubuntu2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../032-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../033-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../034-debhelper_13.3.4ubuntu1_all.deb ... Unpacking debhelper (13.3.4ubuntu1) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../035-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4) ... Selecting previously unselected package help2man. Preparing to unpack .../036-help2man_1.48.1_s390x.deb ... Unpacking help2man (1.48.1) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../037-icu-devtools_67.1-6ubuntu2_s390x.deb ... Unpacking icu-devtools (67.1-6ubuntu2) ... Selecting previously unselected package libroken18-heimdal:s390x. Preparing to unpack .../038-libroken18-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libroken18-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libasn1-8-heimdal:s390x. Preparing to unpack .../039-libasn1-8-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libasn1-8-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libboost1.74-dev:s390x. Preparing to unpack .../040-libboost1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-chrono1.74.0:s390x. Preparing to unpack .../041-libboost-chrono1.74.0_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-chrono1.74.0:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-chrono1.74-dev:s390x. Preparing to unpack .../042-libboost-chrono1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-chrono1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-chrono-dev:s390x. Preparing to unpack .../043-libboost-chrono-dev_1.74.0.3ubuntu5_s390x.deb ... Unpacking libboost-chrono-dev:s390x (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-filesystem1.74.0:s390x. Preparing to unpack .../044-libboost-filesystem1.74.0_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-filesystem1.74.0:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-system1.74.0:s390x. Preparing to unpack .../045-libboost-system1.74.0_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-system1.74.0:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-system1.74-dev:s390x. Preparing to unpack .../046-libboost-system1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-system1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-filesystem1.74-dev:s390x. Preparing to unpack .../047-libboost-filesystem1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-filesystem1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-filesystem-dev:s390x. Preparing to unpack .../048-libboost-filesystem-dev_1.74.0.3ubuntu5_s390x.deb ... Unpacking libboost-filesystem-dev:s390x (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-regex1.74.0:s390x. Preparing to unpack .../049-libboost-regex1.74.0_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-regex1.74.0:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libicu-dev:s390x. Preparing to unpack .../050-libicu-dev_67.1-6ubuntu2_s390x.deb ... Unpacking libicu-dev:s390x (67.1-6ubuntu2) ... Selecting previously unselected package libboost-regex1.74-dev:s390x. Preparing to unpack .../051-libboost-regex1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-regex1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-iostreams1.74.0:s390x. Preparing to unpack .../052-libboost-iostreams1.74.0_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-iostreams1.74.0:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-iostreams1.74-dev:s390x. Preparing to unpack .../053-libboost-iostreams1.74-dev_1.74.0-8ubuntu2_s390x.deb ... Unpacking libboost-iostreams1.74-dev:s390x (1.74.0-8ubuntu2) ... Selecting previously unselected package libboost-iostreams-dev:s390x. Preparing to unpack .../054-libboost-iostreams-dev_1.74.0.3ubuntu5_s390x.deb ... Unpacking libboost-iostreams-dev:s390x (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-system-dev:s390x. Preparing to unpack .../055-libboost-system-dev_1.74.0.3ubuntu5_s390x.deb ... Unpacking libboost-system-dev:s390x (1.74.0.3ubuntu5) ... Selecting previously unselected package libbrotli1:s390x. Preparing to unpack .../056-libbrotli1_1.0.9-2build2_s390x.deb ... Unpacking libbrotli1:s390x (1.0.9-2build2) ... Selecting previously unselected package libheimbase1-heimdal:s390x. Preparing to unpack .../057-libheimbase1-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libheimbase1-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libhcrypto4-heimdal:s390x. Preparing to unpack .../058-libhcrypto4-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libhcrypto4-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libwind0-heimdal:s390x. Preparing to unpack .../059-libwind0-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libwind0-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libhx509-5-heimdal:s390x. Preparing to unpack .../060-libhx509-5-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libhx509-5-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libkrb5-26-heimdal:s390x. Preparing to unpack .../061-libkrb5-26-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libkrb5-26-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libheimntlm0-heimdal:s390x. Preparing to unpack .../062-libheimntlm0-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libheimntlm0-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libgssapi3-heimdal:s390x. Preparing to unpack .../063-libgssapi3-heimdal_7.7.0+dfsg-2_s390x.deb ... Unpacking libgssapi3-heimdal:s390x (7.7.0+dfsg-2) ... Selecting previously unselected package libsasl2-modules-db:s390x. Preparing to unpack .../064-libsasl2-modules-db_2.1.27+dfsg-2ubuntu1_s390x.deb ... Unpacking libsasl2-modules-db:s390x (2.1.27+dfsg-2ubuntu1) ... Selecting previously unselected package libsasl2-2:s390x. Preparing to unpack .../065-libsasl2-2_2.1.27+dfsg-2ubuntu1_s390x.deb ... Unpacking libsasl2-2:s390x (2.1.27+dfsg-2ubuntu1) ... Selecting previously unselected package libldap-2.4-2:s390x. Preparing to unpack .../066-libldap-2.4-2_2.4.57+dfsg-2ubuntu1_s390x.deb ... Unpacking libldap-2.4-2:s390x (2.4.57+dfsg-2ubuntu1) ... Selecting previously unselected package libnghttp2-14:s390x. Preparing to unpack .../067-libnghttp2-14_1.43.0-1_s390x.deb ... Unpacking libnghttp2-14:s390x (1.43.0-1) ... Selecting previously unselected package librtmp1:s390x. Preparing to unpack .../068-librtmp1_2.4+20151223.gitfa8646d.1-2build2_s390x.deb ... Unpacking librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build2) ... Selecting previously unselected package libssh-4:s390x. Preparing to unpack .../069-libssh-4_0.9.5-1ubuntu0.1_s390x.deb ... Unpacking libssh-4:s390x (0.9.5-1ubuntu0.1) ... Selecting previously unselected package libcurl3-gnutls:s390x. Preparing to unpack .../070-libcurl3-gnutls_7.74.0-1ubuntu2.1_s390x.deb ... Unpacking libcurl3-gnutls:s390x (7.74.0-1ubuntu2.1) ... Selecting previously unselected package libcurl4-gnutls-dev:s390x. Preparing to unpack .../071-libcurl4-gnutls-dev_7.74.0-1ubuntu2.1_s390x.deb ... Unpacking libcurl4-gnutls-dev:s390x (7.74.0-1ubuntu2.1) ... Selecting previously unselected package libdeflate0:s390x. Preparing to unpack .../072-libdeflate0_1.7-1ubuntu1_s390x.deb ... Unpacking libdeflate0:s390x (1.7-1ubuntu1) ... Selecting previously unselected package libdeflate-dev:s390x. Preparing to unpack .../073-libdeflate-dev_1.7-1ubuntu1_s390x.deb ... Unpacking libdeflate-dev:s390x (1.7-1ubuntu1) ... Selecting previously unselected package libhts3:s390x. Preparing to unpack .../074-libhts3_1.11-4_s390x.deb ... Unpacking libhts3:s390x (1.11-4) ... Selecting previously unselected package liblzma-dev:s390x. Preparing to unpack .../075-liblzma-dev_5.2.5-1.0build2_s390x.deb ... Unpacking liblzma-dev:s390x (5.2.5-1.0build2) ... Selecting previously unselected package zlib1g-dev:s390x. Preparing to unpack .../076-zlib1g-dev_1%3a1.2.11.dfsg-2ubuntu6_s390x.deb ... Unpacking zlib1g-dev:s390x (1:1.2.11.dfsg-2ubuntu6) ... Selecting previously unselected package libhts-dev:s390x. Preparing to unpack .../077-libhts-dev_1.11-4_s390x.deb ... Unpacking libhts-dev:s390x (1.11-4) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../078-libjs-jquery_3.5.1+dfsg+~3.5.5-7_all.deb ... Unpacking libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../079-libjs-jquery-datatables_1.10.21+dfsg-1_all.deb ... Unpacking libjs-jquery-datatables (1.10.21+dfsg-1) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../080-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-4_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-4) ... Selecting previously unselected package libncurses-dev:s390x. Preparing to unpack .../081-libncurses-dev_6.2+20201114-2build1_s390x.deb ... Unpacking libncurses-dev:s390x (6.2+20201114-2build1) ... Selecting previously unselected package libncurses5-dev:s390x. Preparing to unpack .../082-libncurses5-dev_6.2+20201114-2build1_s390x.deb ... Unpacking libncurses5-dev:s390x (6.2+20201114-2build1) ... Selecting previously unselected package libc-ares2:s390x. Preparing to unpack .../083-libc-ares2_1.17.1-1ubuntu0.1_s390x.deb ... Unpacking libc-ares2:s390x (1.17.1-1ubuntu0.1) ... Selecting previously unselected package libnode72:s390x. Preparing to unpack .../084-libnode72_12.21.0~dfsg-3ubuntu1_s390x.deb ... Unpacking libnode72:s390x (12.21.0~dfsg-3ubuntu1) ... Selecting previously unselected package nodejs. Preparing to unpack .../085-nodejs_12.21.0~dfsg-3ubuntu1_s390x.deb ... Unpacking nodejs (12.21.0~dfsg-3ubuntu1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../086-node-d3-array_1.2.4-3_all.deb ... Unpacking node-d3-array (1.2.4-3) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../087-node-d3-axis_1.0.12-3_all.deb ... Unpacking node-d3-axis (1.0.12-3) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../088-node-d3-dispatch_1.0.6-2_all.deb ... Unpacking node-d3-dispatch (1.0.6-2) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../089-node-d3-selection_1.4.0-6_all.deb ... Unpacking node-d3-selection (1.4.0-6) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../090-node-d3-drag_1.2.5-2_all.deb ... Unpacking node-d3-drag (1.2.5-2) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../091-node-d3-color_1.2.8-2_all.deb ... Unpacking node-d3-color (1.2.8-2) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../092-node-d3-interpolate_1.4.0-2_all.deb ... Unpacking node-d3-interpolate (1.4.0-2) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../093-node-d3-ease_1.0.5-3_all.deb ... Unpacking node-d3-ease (1.0.5-3) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../094-node-d3-timer_1.0.10-1_all.deb ... Unpacking node-d3-timer (1.0.10-1) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../095-node-d3-transition_1.3.2-3_all.deb ... Unpacking node-d3-transition (1.3.2-3) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../096-node-d3-brush_1.1.5-2_all.deb ... Unpacking node-d3-brush (1.1.5-2) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../097-node-d3-path_1.0.9-2_all.deb ... Unpacking node-d3-path (1.0.9-2) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../098-node-d3-chord_1.0.6-3_all.deb ... Unpacking node-d3-chord (1.0.6-3) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../099-node-d3-collection_1.0.7-3_all.deb ... Unpacking node-d3-collection (1.0.7-3) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../100-node-d3-contour_1.3.2-4_all.deb ... Unpacking node-d3-contour (1.3.2-4) ... Selecting previously unselected package node-iconv:s390x. Preparing to unpack .../101-node-iconv_2.3.5-5_s390x.deb ... Unpacking node-iconv:s390x (2.3.5-5) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../102-node-d3-queue_3.0.7-11_all.deb ... Unpacking node-d3-queue (3.0.7-11) ... Selecting previously unselected package node-rw. Preparing to unpack .../103-node-rw_1.3.3-2_all.deb ... Unpacking node-rw (1.3.3-2) ... Selecting previously unselected package node-commander. Preparing to unpack .../104-node-commander_6.2.1-2_all.deb ... Unpacking node-commander (6.2.1-2) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../105-node-d3-dsv_1.1.1-3_all.deb ... Unpacking node-d3-dsv (1.1.1-3) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../106-node-d3-fetch_1.2.0-1_all.deb ... Unpacking node-d3-fetch (1.2.0-1) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../107-node-d3-quadtree_1.0.7-2_all.deb ... Unpacking node-d3-quadtree (1.0.7-2) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../108-node-d3-force_1.2.1-2_all.deb ... Unpacking node-d3-force (1.2.1-2) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../109-libjs-d3-format_1%3a1.4.1-3_all.deb ... Unpacking libjs-d3-format (1:1.4.1-3) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../110-node-d3-format_1%3a1.4.1-3_all.deb ... Unpacking node-d3-format (1:1.4.1-3) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../111-node-d3-geo_1.11.9-4_all.deb ... Unpacking node-d3-geo (1.11.9-4) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../112-node-d3-hierarchy_1.1.8-3_all.deb ... Unpacking node-d3-hierarchy (1.1.8-3) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../113-node-d3-polygon_1.0.5-3_all.deb ... Unpacking node-d3-polygon (1.0.5-3) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../114-node-d3-random_1.1.2-3_all.deb ... Unpacking node-d3-random (1.1.2-3) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../115-node-d3-time_1.0.11-4_all.deb ... Unpacking node-d3-time (1.0.11-4) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../116-node-d3-time-format_2.1.3-3_all.deb ... Unpacking node-d3-time-format (2.1.3-3) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../117-node-d3-scale_2.2.2-3_all.deb ... Unpacking node-d3-scale (2.2.2-3) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../118-node-d3-scale-chromatic_1.5.0-2_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0-2) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../119-node-d3-shape_1.3.7-2_all.deb ... Unpacking node-d3-shape (1.3.7-2) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../120-node-d3-voronoi_1.1.4-3_all.deb ... Unpacking node-d3-voronoi (1.1.4-3) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../121-node-d3-zoom_1.8.3-2_all.deb ... Unpacking node-d3-zoom (1.8.3-2) ... Selecting previously unselected package node-d3. Preparing to unpack .../122-node-d3_5.16.0-4_all.deb ... Unpacking node-d3 (5.16.0-4) ... Selecting previously unselected package sbuild-build-depends-ataqv-dummy. Preparing to unpack .../123-sbuild-build-depends-ataqv-dummy_0.invalid.0_s390x.deb ... Unpacking sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Setting up libboost-chrono1.74.0:s390x (1.74.0-8ubuntu2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:s390x (1.5.3-1) ... Setting up libboost-system1.74.0:s390x (1.74.0-8ubuntu2) ... Setting up libncurses-dev:s390x (6.2+20201114-2build1) ... Setting up libpsl5:s390x (0.21.0-1.2) ... Setting up libboost1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up bsdextrautils (2.36.1-7ubuntu2) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:s390x (67.1-6ubuntu2) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libboost-iostreams1.74.0:s390x (1.74.0-8ubuntu2) ... Setting up libdebhelper-perl (13.3.4ubuntu1) ... Setting up libbrotli1:s390x (1.0.9-2build2) ... Setting up libboost-chrono1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up libnghttp2-14:s390x (1.43.0-1) ... Setting up libmagic1:s390x (1:5.39-3) ... Setting up libdeflate0:s390x (1.7-1ubuntu1) ... Setting up gettext-base (0.21-3ubuntu2) ... Setting up libboost-filesystem1.74.0:s390x (1.74.0-8ubuntu2) ... Setting up libc-ares2:s390x (1.17.1-1ubuntu0.1) ... Setting up file (1:5.39-3) ... Setting up libnode72:s390x (12.21.0~dfsg-3ubuntu1) ... Setting up libsasl2-modules-db:s390x (2.1.27+dfsg-2ubuntu1) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build2) ... Setting up libboost-system1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up libsigsegv2:s390x (2.13-1ubuntu1) ... Setting up libboost-regex1.74.0:s390x (1.74.0-8ubuntu2) ... Setting up autopoint (0.21-3ubuntu2) ... Setting up icu-devtools (67.1-6ubuntu2) ... Setting up libsasl2-2:s390x (2.1.27+dfsg-2ubuntu1) ... Setting up libssh-4:s390x (0.9.5-1ubuntu0.1) ... Setting up libroken18-heimdal:s390x (7.7.0+dfsg-2) ... Setting up liblzma-dev:s390x (5.2.5-1.0build2) ... Setting up zlib1g-dev:s390x (1:1.2.11.dfsg-2ubuntu6) ... Setting up libjs-d3-format (1:1.4.1-3) ... Setting up libuchardet0:s390x (0.0.7-1) ... Setting up libncurses5-dev:s390x (6.2+20201114-2build1) ... Setting up libmpdec3:s390x (2.5.1-2) ... Setting up libsub-override-perl (0.09-2) ... Setting up libboost-filesystem1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Setting up libdeflate-dev:s390x (1.7-1ubuntu1) ... Setting up node-normalize.css (8.0.1-3) ... Setting up libelf1:s390x (0.183-8) ... Setting up libicu-dev:s390x (67.1-6ubuntu2) ... Setting up libxml2:s390x (2.9.10+dfsg-6.3ubuntu0.1) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4) ... Setting up libboost-filesystem-dev:s390x (1.74.0.3ubuntu5) ... Setting up liblocale-gettext-perl (1.07-4build1) ... Setting up libpython3.9-stdlib:s390x (3.9.5-3~21.04) ... Setting up libpython3-stdlib:s390x (3.9.4-1) ... Setting up libheimbase1-heimdal:s390x (7.7.0+dfsg-2) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-4) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up node-iconv:s390x (2.3.5-5) ... Setting up libdw1:s390x (0.183-8) ... Setting up gettext (0.21-3ubuntu2) ... Setting up libtool (2.4.6-15) ... Setting up libboost-chrono-dev:s390x (1.74.0.3ubuntu5) ... Setting up libasn1-8-heimdal:s390x (7.7.0+dfsg-2) ... Setting up libboost-system-dev:s390x (1.74.0.3ubuntu5) ... Setting up m4 (1.4.18-5) ... Setting up nodejs (12.21.0~dfsg-3ubuntu1) ... update-alternatives: using /usr/bin/nodejs to provide /usr/bin/js (js) in auto mode Setting up libhcrypto4-heimdal:s390x (7.7.0+dfsg-2) ... Setting up node-d3-path (1.0.9-2) ... Setting up libjs-jquery-datatables (1.10.21+dfsg-1) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up help2man (1.48.1) ... Setting up libwind0-heimdal:s390x (7.7.0+dfsg-2) ... Setting up node-d3-polygon (1.0.5-3) ... Setting up node-d3-quadtree (1.0.7-2) ... Setting up node-d3-collection (1.0.7-3) ... Setting up autoconf (2.69-14) ... Setting up node-d3-voronoi (1.1.4-3) ... Setting up node-d3-dispatch (1.0.6-2) ... Setting up node-d3-time (1.0.11-4) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up node-commander (6.2.1-2) ... Setting up dwz (0.14-1) ... Setting up node-d3-array (1.2.4-3) ... Setting up libboost-regex1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up groff-base (1.22.4-6) ... Setting up debugedit (1:0.1-0ubuntu2) ... Setting up node-d3-geo (1.11.9-4) ... Setting up node-d3-random (1.1.2-3) ... Setting up python3.9 (3.9.5-3~21.04) ... Setting up automake (1:1.16.3-2ubuntu1) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up node-d3-timer (1.0.10-1) ... Setting up node-d3-color (1.2.8-2) ... Setting up node-d3-interpolate (1.4.0-2) ... Setting up node-d3-queue (3.0.7-11) ... Setting up node-d3-format (1:1.4.1-3) ... Setting up node-d3-hierarchy (1.1.8-3) ... Setting up node-d3-ease (1.0.5-3) ... Setting up node-d3-time-format (2.1.3-3) ... Setting up node-d3-scale-chromatic (1.5.0-2) ... Setting up libhx509-5-heimdal:s390x (7.7.0+dfsg-2) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up node-d3-chord (1.0.6-3) ... Setting up node-d3-selection (1.4.0-6) ... Setting up python3 (3.9.4-1) ... Setting up node-d3-axis (1.0.12-3) ... Setting up node-d3-shape (1.3.7-2) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /lib/systemd/system/man-db.timer. Setting up libboost-iostreams1.74-dev:s390x (1.74.0-8ubuntu2) ... Setting up dh-autoreconf (20) ... Setting up node-d3-drag (1.2.5-2) ... Setting up node-rw (1.3.3-2) ... Setting up node-d3-scale (2.2.2-3) ... Setting up node-d3-force (1.2.1-2) ... Setting up node-d3-contour (1.3.2-4) ... Setting up node-d3-dsv (1.1.1-3) ... Setting up node-d3-transition (1.3.2-3) ... Setting up libkrb5-26-heimdal:s390x (7.7.0+dfsg-2) ... Setting up node-d3-zoom (1.8.3-2) ... Setting up debhelper (13.3.4ubuntu1) ... Setting up node-d3-fetch (1.2.0-1) ... Setting up libboost-iostreams-dev:s390x (1.74.0.3ubuntu5) ... Setting up libheimntlm0-heimdal:s390x (7.7.0+dfsg-2) ... Setting up libgssapi3-heimdal:s390x (7.7.0+dfsg-2) ... Setting up node-d3-brush (1.1.5-2) ... Setting up libldap-2.4-2:s390x (2.4.57+dfsg-2ubuntu1) ... Setting up libcurl3-gnutls:s390x (7.74.0-1ubuntu2.1) ... Setting up node-d3 (5.16.0-4) ... Setting up libcurl4-gnutls-dev:s390x (7.74.0-1ubuntu2.1) ... Setting up libhts3:s390x (1.11-4) ... Setting up libhts-dev:s390x (1.11-4) ... Setting up sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.33-0ubuntu5) ... +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 4.15.0-156-generic s390x (s390x) Toolchain package versions: binutils_2.36.1-6ubuntu1 dpkg-dev_1.20.9ubuntu1 g++-10_10.3.0-1ubuntu1 gcc-10_10.3.0-1ubuntu1 libc6-dev_2.33-0ubuntu5 libstdc++-10-dev_10.3.0-1ubuntu1 libstdc++6_11.1.0-1ubuntu1~21.04 linux-libc-dev_5.11.0-35.37 Package versions: adduser_3.118ubuntu5 advancecomp_2.1-2.1build1 apt_2.2.4ubuntu0.1 autoconf_2.69-14 automake_1:1.16.3-2ubuntu1 autopoint_0.21-3ubuntu2 autotools-dev_20180224.1+nmu1 base-files_11ubuntu19 base-passwd_3.5.49ubuntu1 bash_5.1-2ubuntu1 binutils_2.36.1-6ubuntu1 binutils-common_2.36.1-6ubuntu1 binutils-s390x-linux-gnu_2.36.1-6ubuntu1 bsdextrautils_2.36.1-7ubuntu2 bsdutils_1:2.36.1-7ubuntu2 build-essential_12.8ubuntu3 bzip2_1.0.8-4ubuntu3 ca-certificates_20210119build1 coreutils_8.32-4ubuntu2 cpp_4:10.3.0-1ubuntu1 cpp-10_10.3.0-1ubuntu1 dash_0.5.11+git20200708+dd9ef66+really0.5.11+git20200708+dd9ef66-5ubuntu1 debconf_1.5.74 debhelper_13.3.4ubuntu1 debianutils_4.11.2 debugedit_1:0.1-0ubuntu2 dh-autoreconf_20 dh-strip-nondeterminism_1.11.0-1 diffutils_1:3.7-3ubuntu1 dpkg_1.20.9ubuntu1 dpkg-dev_1.20.9ubuntu1 dwz_0.14-1 e2fsprogs_1.45.7-1ubuntu2 fakeroot_1.25.3-1.1ubuntu2 file_1:5.39-3 findutils_4.8.0-1ubuntu1 fonts-font-awesome_5.0.10+really4.7.0~dfsg-4 g++_4:10.3.0-1ubuntu1 g++-10_10.3.0-1ubuntu1 gcc_4:10.3.0-1ubuntu1 gcc-10_10.3.0-1ubuntu1 gcc-10-base_10.3.0-1ubuntu1 gcc-11-base_11.1.0-1ubuntu1~21.04 gettext_0.21-3ubuntu2 gettext-base_0.21-3ubuntu2 gpg_2.2.20-1ubuntu3 gpg-agent_2.2.20-1ubuntu3 gpgconf_2.2.20-1ubuntu3 gpgv_2.2.20-1ubuntu3 grep_3.6-1 groff-base_1.22.4-6 gzip_1.10-2ubuntu3 help2man_1.48.1 hostname_3.23 icu-devtools_67.1-6ubuntu2 init_1.60 init-system-helpers_1.60 intltool-debian_0.35.0+20060710.5 libacl1_2.2.53-10ubuntu1 libapparmor1_3.0.0-0ubuntu7.1 libapt-pkg6.0_2.2.4ubuntu0.1 libarchive-zip-perl_1.68-1 libargon2-1_0~20171227-0.2build21.04.0 libasan6_11.1.0-1ubuntu1~21.04 libasn1-8-heimdal_7.7.0+dfsg-2 libassuan0_2.5.4-1ubuntu1 libatomic1_11.1.0-1ubuntu1~21.04 libattr1_1:2.4.48-6build1 libaudit-common_1:3.0-2ubuntu1 libaudit1_1:3.0-2ubuntu1 libbinutils_2.36.1-6ubuntu1 libblkid1_2.36.1-7ubuntu2 libboost-chrono-dev_1.74.0.3ubuntu5 libboost-chrono1.74-dev_1.74.0-8ubuntu2 libboost-chrono1.74.0_1.74.0-8ubuntu2 libboost-filesystem-dev_1.74.0.3ubuntu5 libboost-filesystem1.74-dev_1.74.0-8ubuntu2 libboost-filesystem1.74.0_1.74.0-8ubuntu2 libboost-iostreams-dev_1.74.0.3ubuntu5 libboost-iostreams1.74-dev_1.74.0-8ubuntu2 libboost-iostreams1.74.0_1.74.0-8ubuntu2 libboost-regex1.74-dev_1.74.0-8ubuntu2 libboost-regex1.74.0_1.74.0-8ubuntu2 libboost-system-dev_1.74.0.3ubuntu5 libboost-system1.74-dev_1.74.0-8ubuntu2 libboost-system1.74.0_1.74.0-8ubuntu2 libboost1.74-dev_1.74.0-8ubuntu2 libbrotli1_1.0.9-2build2 libbz2-1.0_1.0.8-4ubuntu3 libc-ares2_1.17.1-1ubuntu0.1 libc-bin_2.33-0ubuntu5 libc-dev-bin_2.33-0ubuntu5 libc6_2.33-0ubuntu5 libc6-dev_2.33-0ubuntu5 libcap-ng0_0.7.9-2.2build1 libcap2_1:2.44-1build1 libcc1-0_11.1.0-1ubuntu1~21.04 libcom-err2_1.45.7-1ubuntu2 libcrypt-dev_1:4.4.17-1ubuntu3 libcrypt1_1:4.4.17-1ubuntu3 libcryptsetup12_2:2.3.4-1ubuntu3 libctf-nobfd0_2.36.1-6ubuntu1 libctf0_2.36.1-6ubuntu1 libcurl3-gnutls_7.74.0-1ubuntu2.1 libcurl4-gnutls-dev_7.74.0-1ubuntu2.1 libdb5.3_5.3.28+dfsg1-0.6ubuntu4 libdebconfclient0_0.256ubuntu3 libdebhelper-perl_13.3.4ubuntu1 libdeflate-dev_1.7-1ubuntu1 libdeflate0_1.7-1ubuntu1 libdevmapper1.02.1_2:1.02.175-2ubuntu4 libdpkg-perl_1.20.9ubuntu1 libdw1_0.183-8 libelf1_0.183-8 libexpat1_2.2.10-2 libext2fs2_1.45.7-1ubuntu2 libfakeroot_1.25.3-1.1ubuntu2 libffi8ubuntu1_3.4~20200819gead65ca871-0ubuntu5 libfile-stripnondeterminism-perl_1.11.0-1 libgcc-10-dev_10.3.0-1ubuntu1 libgcc-s1_11.1.0-1ubuntu1~21.04 libgcrypt20_1.8.7-2ubuntu2 libgdbm-compat4_1.19-2 libgdbm6_1.19-2 libgmp10_2:6.2.1+dfsg-1ubuntu2 libgnutls30_3.7.1-3ubuntu1 libgomp1_11.1.0-1ubuntu1~21.04 libgpg-error0_1.38-2build1 libgssapi-krb5-2_1.18.3-4 libgssapi3-heimdal_7.7.0+dfsg-2 libhcrypto4-heimdal_7.7.0+dfsg-2 libheimbase1-heimdal_7.7.0+dfsg-2 libheimntlm0-heimdal_7.7.0+dfsg-2 libhogweed6_3.7-2.1ubuntu1.1 libhts-dev_1.11-4 libhts3_1.11-4 libhx509-5-heimdal_7.7.0+dfsg-2 libicu-dev_67.1-6ubuntu2 libicu67_67.1-6ubuntu2 libidn2-0_2.3.0-5 libip4tc2_1.8.7-1ubuntu2 libisl23_0.23-1build1 libitm1_11.1.0-1ubuntu1~21.04 libjs-d3-format_1:1.4.1-3 libjs-jquery_3.5.1+dfsg+~3.5.5-7 libjs-jquery-datatables_1.10.21+dfsg-1 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-4 libjson-c5_0.15-2build2 libk5crypto3_1.18.3-4 libkeyutils1_1.6.1-2ubuntu1 libkmod2_28-1ubuntu2 libkrb5-26-heimdal_7.7.0+dfsg-2 libkrb5-3_1.18.3-4 libkrb5support0_1.18.3-4 libldap-2.4-2_2.4.57+dfsg-2ubuntu1 liblocale-gettext-perl_1.07-4build1 liblockfile-bin_1.17-1 liblockfile1_1.17-1 liblz4-1_1.9.3-1ubuntu0.1 liblzma-dev_5.2.5-1.0build2 liblzma5_5.2.5-1.0build2 libmagic-mgc_1:5.39-3 libmagic1_1:5.39-3 libmount1_2.36.1-7ubuntu2 libmpc3_1.2.0-1build1 libmpdec3_2.5.1-2 libmpfr6_4.1.0-3build1 libncurses-dev_6.2+20201114-2build1 libncurses5-dev_6.2+20201114-2build1 libncurses6_6.2+20201114-2build1 libncursesw6_6.2+20201114-2build1 libnettle8_3.7-2.1ubuntu1.1 libnghttp2-14_1.43.0-1 libnode72_12.21.0~dfsg-3ubuntu1 libnpth0_1.6-3 libnsl-dev_1.3.0-0ubuntu3 libnsl2_1.3.0-0ubuntu3 libp11-kit0_0.23.22-1 libpam-modules_1.3.1-5ubuntu6.21.04.1 libpam-modules-bin_1.3.1-5ubuntu6.21.04.1 libpam-runtime_1.3.1-5ubuntu6.21.04.1 libpam0g_1.3.1-5ubuntu6.21.04.1 libpcre2-8-0_10.36-2ubuntu5 libpcre3_2:8.39-13build3 libperl5.32_5.32.1-3ubuntu2.1 libpipeline1_1.5.3-1 libpng16-16_1.6.37-3build3 libprocps8_2:3.3.16-5ubuntu3.1 libpsl5_0.21.0-1.2 libpython3-stdlib_3.9.4-1 libpython3.9-minimal_3.9.5-3~21.04 libpython3.9-stdlib_3.9.5-3~21.04 libreadline8_8.1-1 libroken18-heimdal_7.7.0+dfsg-2 librtmp1_2.4+20151223.gitfa8646d.1-2build2 libsasl2-2_2.1.27+dfsg-2ubuntu1 libsasl2-modules-db_2.1.27+dfsg-2ubuntu1 libseccomp2_2.5.1-1ubuntu1 libselinux1_3.1-3build1 libsemanage-common_3.1-1ubuntu1 libsemanage1_3.1-1ubuntu1 libsepol1_3.1-1ubuntu1 libsigsegv2_2.13-1ubuntu1 libsmartcols1_2.36.1-7ubuntu2 libsqlite3-0_3.34.1-3 libss2_1.45.7-1ubuntu2 libssh-4_0.9.5-1ubuntu0.1 libssl1.1_1.1.1j-1ubuntu3.5 libstdc++-10-dev_10.3.0-1ubuntu1 libstdc++6_11.1.0-1ubuntu1~21.04 libsub-override-perl_0.09-2 libsystemd0_247.3-3ubuntu3.6 libtasn1-6_4.16.0-2 libtinfo6_6.2+20201114-2build1 libtirpc-common_1.3.1-1build1 libtirpc-dev_1.3.1-1build1 libtirpc3_1.3.1-1build1 libtool_2.4.6-15 libubsan1_11.1.0-1ubuntu1~21.04 libuchardet0_0.0.7-1 libudev1_247.3-3ubuntu3.6 libunistring2_0.9.10-4 libuuid1_2.36.1-7ubuntu2 libwind0-heimdal_7.7.0+dfsg-2 libxml2_2.9.10+dfsg-6.3ubuntu0.1 libxxhash0_0.8.0-2 libzstd1_1.4.8+dfsg-2build2 linux-libc-dev_5.11.0-35.37 lockfile-progs_0.1.18 login_1:4.8.1-1ubuntu8.1 logsave_1.45.7-1ubuntu2 lsb-base_11.1.0ubuntu2 lto-disabled-list_7 m4_1.4.18-5 make_4.3-4ubuntu1 man-db_2.9.4-2 mawk_1.3.4.20200120-2 media-types_4.0.0 mount_2.36.1-7ubuntu2 ncurses-base_6.2+20201114-2build1 ncurses-bin_6.2+20201114-2build1 node-commander_6.2.1-2 node-d3_5.16.0-4 node-d3-array_1.2.4-3 node-d3-axis_1.0.12-3 node-d3-brush_1.1.5-2 node-d3-chord_1.0.6-3 node-d3-collection_1.0.7-3 node-d3-color_1.2.8-2 node-d3-contour_1.3.2-4 node-d3-dispatch_1.0.6-2 node-d3-drag_1.2.5-2 node-d3-dsv_1.1.1-3 node-d3-ease_1.0.5-3 node-d3-fetch_1.2.0-1 node-d3-force_1.2.1-2 node-d3-format_1:1.4.1-3 node-d3-geo_1.11.9-4 node-d3-hierarchy_1.1.8-3 node-d3-interpolate_1.4.0-2 node-d3-path_1.0.9-2 node-d3-polygon_1.0.5-3 node-d3-quadtree_1.0.7-2 node-d3-queue_3.0.7-11 node-d3-random_1.1.2-3 node-d3-scale_2.2.2-3 node-d3-scale-chromatic_1.5.0-2 node-d3-selection_1.4.0-6 node-d3-shape_1.3.7-2 node-d3-time_1.0.11-4 node-d3-time-format_2.1.3-3 node-d3-timer_1.0.10-1 node-d3-transition_1.3.2-3 node-d3-voronoi_1.1.4-3 node-d3-zoom_1.8.3-2 node-iconv_2.3.5-5 node-normalize.css_8.0.1-3 node-rw_1.3.3-2 nodejs_12.21.0~dfsg-3ubuntu1 openssl_1.1.1j-1ubuntu3.5 optipng_0.7.7-1 passwd_1:4.8.1-1ubuntu8.1 patch_2.7.6-7 perl_5.32.1-3ubuntu2.1 perl-base_5.32.1-3ubuntu2.1 perl-modules-5.32_5.32.1-3ubuntu2.1 pinentry-curses_1.1.0-4build1 pkgbinarymangler_147 po-debconf_1.0.21+nmu1 policyrcd-script-zg2_0.1-3 procps_2:3.3.16-5ubuntu3.1 python3_3.9.4-1 python3-minimal_3.9.4-1 python3.9_3.9.5-3~21.04 python3.9-minimal_3.9.5-3~21.04 readline-common_8.1-1 rpcsvc-proto_1.4.2-0ubuntu4 sbuild-build-depends-ataqv-dummy_0.invalid.0 sbuild-build-depends-core-dummy_0.invalid.0 sed_4.7-1ubuntu1 sensible-utils_0.0.14 systemd_247.3-3ubuntu3.6 systemd-sysv_247.3-3ubuntu3.6 systemd-timesyncd_247.3-3ubuntu3.6 sysvinit-utils_2.96-6ubuntu1 tar_1.34+dfsg-1build1 tzdata_2021a-1ubuntu1 ubuntu-keyring_2021.03.26 usrmerge_24ubuntu3 util-linux_2.36.1-7ubuntu2 xz-utils_5.2.5-1.0build2 zlib1g_1:1.2.11.dfsg-2ubuntu6 zlib1g-dev_1:1.2.11.dfsg-2ubuntu6 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- gpgv: Signature made Sat Dec 12 12:17:40 2020 UTC gpgv: using RSA key D56571B88A8BBAF140BF63D6BD7EAA60778FA6F5 gpgv: issuer "doko@ubuntu.com" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./ataqv_1.2.1+ds-1build1.dsc dpkg-source: info: extracting ataqv in /<>/ataqv-1.2.1+ds dpkg-source: info: unpacking ataqv_1.2.1+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.2.1+ds-1build1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-20400306 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-20400306 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-20400306 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.2.1+ds-1build1 dpkg-buildpackage: info: source distribution hirsute dpkg-source --before-build . dpkg-buildpackage: info: host architecture s390x debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_clean debian/rules binary-arch dh binary-arch dh_update_autotools_config -a dh_autoreconf -a debian/rules override_dh_auto_configure make[1]: Entering directory '/<>/ataqv-1.2.1+ds' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' debian/rules override_dh_auto_build make[1]: Entering directory '/<>/ataqv-1.2.1+ds' dh_auto_build -- all testing/run_ataqv_tests make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/<>/ataqv-1.2.1+ds' g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/ataqv.o -c /<>/ataqv-1.2.1+ds/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /<>/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_features.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_hts.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_io.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_io.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:172:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 172 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:177:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 177 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____242()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:248:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 248 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____251()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:258:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 258 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_auto_test -a make -j4 test make[1]: Entering directory '/<>/ataqv-1.2.1+ds' ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ run_ataqv_tests is a Catch v1.5.7 host application. Run with -? for options ------------------------------------------------------------------------------- Test bad HTS record ------------------------------------------------------------------------------- ./src/cpp/test_hts.cpp:169 ............................................................................... ./src/cpp/test_hts.cpp:200: FAILED: REQUIRE_THROWS_AS( record_to_string(header, record) ) because no exception was thrown where one was expected: Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 1.55827 seconds. (16036.4 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 12.5928 seconds. (2960.11 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 12.4793 seconds. (2987.02 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 12.306 seconds. (3029.067 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. =============================================================================== test cases: 54 | 53 passed | 1 failed assertions: 241 | 240 passed | 1 failed make[1]: *** [Makefile:187: test] Error 1 make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_auto_test: error: make -j4 test returned exit code 2 make: *** [debian/rules:12: binary-arch] Error 25 dpkg-buildpackage: error: debian/rules binary-arch subprocess returned exit status 2 -------------------------------------------------------------------------------- Build finished at 2021-09-10T18:12:20Z Finished -------- +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested E: Build failure (dpkg-buildpackage died) +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: s390x Build Type: any Build-Space: n/a Build-Time: 76 Distribution: hirsute-proposed Fail-Stage: build Host Architecture: s390x Install-Time: 22 Job: ataqv_1.2.1+ds-1build1.dsc Machine Architecture: s390x Package: ataqv Package-Time: 98 Source-Version: 1.2.1+ds-1build1 Space: n/a Status: attempted Version: 1.2.1+ds-1build1 -------------------------------------------------------------------------------- Finished at 2021-09-10T18:12:20Z Build needed 00:01:38, no disk space E: Build failure (dpkg-buildpackage died) Adding user buildd to group lxd RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=hirsute --arch=s390x PACKAGEBUILD-20400306 Scanning for processes to kill in build PACKAGEBUILD-20400306