https://launchpad.net/ubuntu/+source/ataqv/1.2.1+ds-1build1/+build/20400304 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux bos02-ppc64el-019 4.15.0-128-generic #131-Ubuntu SMP Wed Dec 9 06:54:14 UTC 2020 ppc64le Buildd toolchain package versions: launchpad-buildd_193~468~ubuntu18.04.1 python3-lpbuildd_193~468~ubuntu18.04.1 sbuild_0.75.0-1ubuntu1 bzr-builder_0.7.3+bzr174~ppa13~ubuntu16.04.1 bzr_2.7.0+bzr6622-10 git-build-recipe_0.3.6~git201906051340.ff11471~ubuntu18.04.1 git_1:2.17.1-1ubuntu0.7 dpkg-dev_1.19.0.5ubuntu2.3 python-debian_0.1.32 python3-debian_0.1.32. Syncing the system clock with the buildd NTP service... 12 Dec 12:33:48 ntpdate[1995]: adjust time server 10.211.37.1 offset 0.002335 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=hirsute --arch=ppc64el PACKAGEBUILD-20400304 --image-type chroot /home/buildd/filecache-default/562b8b0d733db483afe9600af35c69ac54075a74 Creating target for build PACKAGEBUILD-20400304 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=hirsute --arch=ppc64el PACKAGEBUILD-20400304 Starting target for build PACKAGEBUILD-20400304 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=hirsute --arch=ppc64el PACKAGEBUILD-20400304 'deb http://ftpmaster.internal/ubuntu hirsute main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-security main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-updates main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-20400304 RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=hirsute --arch=ppc64el PACKAGEBUILD-20400304 Updating target for build PACKAGEBUILD-20400304 Get:1 http://ftpmaster.internal/ubuntu hirsute InRelease [269 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute-security InRelease [90.7 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-updates InRelease [90.7 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-proposed InRelease [121 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute/main ppc64el Packages [1350 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main Translation-en [511 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el Packages [12.6 MB] Get:8 http://ftpmaster.internal/ubuntu hirsute/universe Translation-en [5363 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el Packages [161 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-proposed/main Translation-en [63.4 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-proposed/universe ppc64el Packages [649 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute-proposed/universe Translation-en [329 kB] Fetched 21.6 MB in 8s (2666 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages were automatically installed and are no longer required: libisl22 libperl5.30 perl-modules-5.30 Use 'sudo apt autoremove' to remove them. The following NEW packages will be installed: libisl23 libperl5.32 perl-modules-5.32 The following packages will be upgraded: adduser apt base-files base-passwd bash binutils binutils-common binutils-powerpc64le-linux-gnu bsdutils coreutils cpp-10 dash dpkg dpkg-dev fakeroot g++-10 gcc-10 gcc-10-base grep init init-system-helpers libapparmor1 libapt-pkg6.0 libasan6 libatomic1 libaudit-common libaudit1 libbinutils libblkid1 libc-bin libc-dev-bin libc6 libc6-dev libcap-ng0 libcap2 libcc1-0 libcrypt-dev libcrypt1 libcryptsetup12 libctf-nobfd0 libctf0 libdebconfclient0 libdevmapper1.02.1 libdpkg-perl libfakeroot libgcc-10-dev libgcc-s1 libgcrypt20 libgomp1 libgssapi-krb5-2 libidn2-0 libip4tc2 libitm1 libk5crypto3 libkrb5-3 libkrb5support0 liblsan0 liblz4-1 libmount1 libmpc3 libncurses6 libncursesw6 libnpth0 libpcre2-8-0 libquadmath0 libreadline8 libseccomp2 libselinux1 libsemanage-common libsemanage1 libsmartcols1 libsqlite3-0 libssl1.1 libstdc++-10-dev libstdc++6 libsystemd0 libtinfo6 libtirpc-common libtirpc-dev libtirpc3 libtsan0 libubsan1 libudev1 libuuid1 linux-libc-dev login mount ncurses-base ncurses-bin openssl passwd perl perl-base readline-common systemd systemd-sysv systemd-timesyncd sysvinit-utils tar tzdata util-linux 101 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. Need to get 173 MB of archives. After this operation, 462 MB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcrypt-dev ppc64el 1:4.4.17-1ubuntu1 [131 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libc6-dev ppc64el 2.32-0ubuntu5 [2131 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libc-dev-bin ppc64el 2.32-0ubuntu5 [31.4 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcrypt1 ppc64el 1:4.4.17-1ubuntu1 [99.8 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el linux-libc-dev ppc64el 5.8.0-32.34+21.04.1 [1134 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtirpc-common all 1.2.6-3 [7444 B] Get:7 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libk5crypto3 ppc64el 1.17-10ubuntu1 [105 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgssapi-krb5-2 ppc64el 1.17-10ubuntu1 [135 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libkrb5-3 ppc64el 1.17-10ubuntu1 [375 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libkrb5support0 ppc64el 1.17-10ubuntu1 [34.8 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libssl1.1 ppc64el 1.1.1f-1ubuntu5 [1363 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtirpc-dev ppc64el 1.2.6-3 [208 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtirpc3 ppc64el 1.2.6-3 [89.2 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libisl23 ppc64el 0.23-1 [713 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcc1-0 ppc64el 10.2.1-1ubuntu1 [42.0 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute/main ppc64el gcc-10-base ppc64el 10.2.1-1ubuntu1 [19.4 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgcc-s1 ppc64el 10.2.1-1ubuntu1 [30.1 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgomp1 ppc64el 10.2.1-1ubuntu1 [108 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libitm1 ppc64el 10.2.1-1ubuntu1 [28.6 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libatomic1 ppc64el 10.2.1-1ubuntu1 [9976 B] Get:21 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libasan6 ppc64el 10.2.1-1ubuntu1 [2105 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute/main ppc64el liblsan0 ppc64el 10.2.1-1ubuntu1 [847 kB] Get:23 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtsan0 ppc64el 10.2.1-1ubuntu1 [2029 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libubsan1 ppc64el 10.2.1-1ubuntu1 [800 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libquadmath0 ppc64el 10.2.1-1ubuntu1 [149 kB] Get:26 http://ftpmaster.internal/ubuntu hirsute/main ppc64el g++-10 ppc64el 10.2.1-1ubuntu1 [41.1 MB] Get:27 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libstdc++-10-dev ppc64el 10.2.1-1ubuntu1 [1793 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgcc-10-dev ppc64el 10.2.1-1ubuntu1 [1247 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute/main ppc64el gcc-10 ppc64el 10.2.1-1ubuntu1 [44.0 MB] Get:30 http://ftpmaster.internal/ubuntu hirsute/main ppc64el cpp-10 ppc64el 10.2.1-1ubuntu1 [37.6 MB] Get:31 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libstdc++6 ppc64el 10.2.1-1ubuntu1 [541 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libmpc3 ppc64el 1.2.0-1 [47.1 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libctf0 ppc64el 2.35.50.20201210-0ubuntu2 [85.5 kB] Get:34 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libctf-nobfd0 ppc64el 2.35.50.20201210-0ubuntu2 [85.8 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libbinutils ppc64el 2.35.50.20201210-0ubuntu2 [534 kB] Get:36 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el binutils-common ppc64el 2.35.50.20201210-0ubuntu2 [216 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el binutils ppc64el 2.35.50.20201210-0ubuntu2 [3384 B] Get:38 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el binutils-powerpc64le-linux-gnu ppc64el 2.35.50.20201210-0ubuntu2 [1827 kB] Get:39 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libc6 ppc64el 2.32-0ubuntu5 [2673 kB] Get:40 http://ftpmaster.internal/ubuntu hirsute/main ppc64el base-files ppc64el 11ubuntu16 [60.7 kB] Get:41 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el bash ppc64el 5.1-1ubuntu1 [748 kB] Get:42 http://ftpmaster.internal/ubuntu hirsute/main ppc64el bsdutils ppc64el 1:2.36.1-1ubuntu2 [91.9 kB] Get:43 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el coreutils ppc64el 8.32-4ubuntu2 [1411 kB] Get:44 http://ftpmaster.internal/ubuntu hirsute/main ppc64el tar ppc64el 1.32+dfsg-1 [317 kB] Get:45 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dpkg ppc64el 1.20.5ubuntu3 [1199 kB] Get:46 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dash ppc64el 0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1 [101 kB] Get:47 http://ftpmaster.internal/ubuntu hirsute/main ppc64el grep ppc64el 3.6-1 [160 kB] Get:48 http://ftpmaster.internal/ubuntu hirsute/main ppc64el login ppc64el 1:4.8.1-1ubuntu7 [223 kB] Get:49 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libncurses6 ppc64el 6.2+20201114-1 [122 kB] Get:50 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libncursesw6 ppc64el 6.2+20201114-1 [153 kB] Get:51 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtinfo6 ppc64el 6.2+20201114-1 [104 kB] Get:52 http://ftpmaster.internal/ubuntu hirsute/main ppc64el ncurses-bin ppc64el 6.2+20201114-1 [180 kB] Get:53 http://ftpmaster.internal/ubuntu hirsute/main ppc64el perl-modules-5.32 all 5.32.0-5 [2754 kB] Get:54 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libperl5.32 ppc64el 5.32.0-5 [4037 kB] Get:55 http://ftpmaster.internal/ubuntu hirsute/main ppc64el perl ppc64el 5.32.0-5 [225 kB] Get:56 http://ftpmaster.internal/ubuntu hirsute/main ppc64el perl-base ppc64el 5.32.0-5 [1546 kB] Get:57 http://ftpmaster.internal/ubuntu hirsute/main ppc64el util-linux ppc64el 2.36.1-1ubuntu2 [1118 kB] Get:58 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libdebconfclient0 ppc64el 0.255ubuntu1 [6148 B] Get:59 http://ftpmaster.internal/ubuntu hirsute/main ppc64el base-passwd ppc64el 3.5.48 [49.6 kB] Get:60 http://ftpmaster.internal/ubuntu hirsute/main ppc64el init-system-helpers all 1.59 [38.2 kB] Get:61 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libc-bin ppc64el 2.32-0ubuntu5 [637 kB] Get:62 http://ftpmaster.internal/ubuntu hirsute/main ppc64el ncurses-base all 6.2+20201114-1 [18.5 kB] Get:63 http://ftpmaster.internal/ubuntu hirsute/main ppc64el sysvinit-utils ppc64el 2.96-5ubuntu1 [22.8 kB] Get:64 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgcrypt20 ppc64el 1.8.7-2ubuntu1 [444 kB] Get:65 http://ftpmaster.internal/ubuntu hirsute/main ppc64el liblz4-1 ppc64el 1.9.3-0ubuntu1 [70.0 kB] Get:66 http://ftpmaster.internal/ubuntu hirsute/main ppc64el systemd-sysv ppc64el 246.6-5ubuntu1 [10.3 kB] Get:67 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libaudit-common all 1:2.8.5-3ubuntu3 [4048 B] Get:68 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcap-ng0 ppc64el 0.7.9-2.2build1 [11.7 kB] Get:69 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libaudit1 ppc64el 1:2.8.5-3ubuntu3 [42.5 kB] Get:70 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libpcre2-8-0 ppc64el 10.35-2ubuntu1 [204 kB] Get:71 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libselinux1 ppc64el 3.1-2build2 [81.5 kB] Get:72 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsemanage-common all 3.1-1build2 [10.0 kB] Get:73 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsemanage1 ppc64el 3.1-1build2 [97.0 kB] Get:74 http://ftpmaster.internal/ubuntu hirsute/main ppc64el passwd ppc64el 1:4.8.1-1ubuntu7 [804 kB] Get:75 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el adduser all 3.118ubuntu4 [163 kB] Get:76 http://ftpmaster.internal/ubuntu hirsute/main ppc64el systemd-timesyncd ppc64el 246.6-5ubuntu1 [28.8 kB] Get:77 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libapparmor1 ppc64el 3.0.0-0ubuntu5 [39.6 kB] Get:78 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcap2 ppc64el 1:2.44-1 [19.8 kB] Get:79 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libblkid1 ppc64el 2.36.1-1ubuntu2 [151 kB] Get:80 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libudev1 ppc64el 246.6-5ubuntu1 [82.8 kB] Get:81 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libdevmapper1.02.1 ppc64el 2:1.02.167-1ubuntu4 [157 kB] Get:82 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libuuid1 ppc64el 2.36.1-1ubuntu2 [23.1 kB] Get:83 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcryptsetup12 ppc64el 2:2.3.4-1ubuntu1 [228 kB] Get:84 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libidn2-0 ppc64el 2.3.0-4 [55.3 kB] Get:85 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libip4tc2 ppc64el 1.8.5-3ubuntu4 [22.0 kB] Get:86 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libmount1 ppc64el 2.36.1-1ubuntu2 [166 kB] Get:87 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libseccomp2 ppc64el 2.4.3-1ubuntu6 [47.7 kB] Get:88 http://ftpmaster.internal/ubuntu hirsute/main ppc64el mount ppc64el 2.36.1-1ubuntu2 [128 kB] Get:89 http://ftpmaster.internal/ubuntu hirsute/main ppc64el systemd ppc64el 246.6-5ubuntu1 [4893 kB] Get:90 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsystemd0 ppc64el 246.6-5ubuntu1 [315 kB] Get:91 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libapt-pkg6.0 ppc64el 2.1.13 [930 kB] Get:92 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el apt ppc64el 2.1.13 [1328 kB] Get:93 http://ftpmaster.internal/ubuntu hirsute/main ppc64el init ppc64el 1.59 [6168 B] Get:94 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsmartcols1 ppc64el 2.36.1-1ubuntu2 [107 kB] Get:95 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el readline-common all 8.1-1 [54.1 kB] Get:96 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libreadline8 ppc64el 8.1-1 [151 kB] Get:97 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libsqlite3-0 ppc64el 3.34.0-1 [628 kB] Get:98 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el openssl ppc64el 1.1.1f-1ubuntu5 [621 kB] Get:99 http://ftpmaster.internal/ubuntu hirsute/main ppc64el tzdata all 2020d-1ubuntu1 [293 kB] Get:100 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dpkg-dev all 1.20.5ubuntu3 [758 kB] Get:101 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libdpkg-perl all 1.20.5ubuntu3 [232 kB] Get:102 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libfakeroot ppc64el 1.25.3-1.1 [28.6 kB] Get:103 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el fakeroot ppc64el 1.25.3-1.1 [66.4 kB] Get:104 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libnpth0 ppc64el 1.6-3 [8640 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 173 MB in 18s (9707 kB/s) (Reading database ... 12922 files and directories currently installed.) Preparing to unpack .../libcrypt-dev_1%3a4.4.17-1ubuntu1_ppc64el.deb ... Unpacking libcrypt-dev:ppc64el (1:4.4.17-1ubuntu1) over (1:4.4.16-1ubuntu1) ... Preparing to unpack .../libc6-dev_2.32-0ubuntu5_ppc64el.deb ... Unpacking libc6-dev:ppc64el (2.32-0ubuntu5) over (2.32-0ubuntu3) ... Preparing to unpack .../libc-dev-bin_2.32-0ubuntu5_ppc64el.deb ... Unpacking libc-dev-bin (2.32-0ubuntu5) over (2.32-0ubuntu3) ... Preparing to unpack .../libcrypt1_1%3a4.4.17-1ubuntu1_ppc64el.deb ... Unpacking libcrypt1:ppc64el (1:4.4.17-1ubuntu1) over (1:4.4.16-1ubuntu1) ... Setting up libcrypt1:ppc64el (1:4.4.17-1ubuntu1) ... (Reading database ... 12921 files and directories currently installed.) Preparing to unpack .../00-linux-libc-dev_5.8.0-32.34+21.04.1_ppc64el.deb ... Unpacking linux-libc-dev:ppc64el (5.8.0-32.34+21.04.1) over (5.8.0-25.26) ... Preparing to unpack .../01-libtirpc-common_1.2.6-3_all.deb ... Unpacking libtirpc-common (1.2.6-3) over (1.2.6-1build1) ... Preparing to unpack .../02-libk5crypto3_1.17-10ubuntu1_ppc64el.deb ... Unpacking libk5crypto3:ppc64el (1.17-10ubuntu1) over (1.17-10) ... Preparing to unpack .../03-libgssapi-krb5-2_1.17-10ubuntu1_ppc64el.deb ... Unpacking libgssapi-krb5-2:ppc64el (1.17-10ubuntu1) over (1.17-10) ... Preparing to unpack .../04-libkrb5-3_1.17-10ubuntu1_ppc64el.deb ... Unpacking libkrb5-3:ppc64el (1.17-10ubuntu1) over (1.17-10) ... Preparing to unpack .../05-libkrb5support0_1.17-10ubuntu1_ppc64el.deb ... Unpacking libkrb5support0:ppc64el (1.17-10ubuntu1) over (1.17-10) ... Preparing to unpack .../06-libssl1.1_1.1.1f-1ubuntu5_ppc64el.deb ... Unpacking libssl1.1:ppc64el (1.1.1f-1ubuntu5) over (1.1.1f-1ubuntu4) ... Preparing to unpack .../07-libtirpc-dev_1.2.6-3_ppc64el.deb ... Unpacking libtirpc-dev:ppc64el (1.2.6-3) over (1.2.6-1build1) ... Preparing to unpack .../08-libtirpc3_1.2.6-3_ppc64el.deb ... Unpacking libtirpc3:ppc64el (1.2.6-3) over (1.2.6-1build1) ... Selecting previously unselected package libisl23:ppc64el. Preparing to unpack .../09-libisl23_0.23-1_ppc64el.deb ... Unpacking libisl23:ppc64el (0.23-1) ... Preparing to unpack .../10-libcc1-0_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libcc1-0:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../11-gcc-10-base_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking gcc-10-base:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Setting up gcc-10-base:ppc64el (10.2.1-1ubuntu1) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../libgcc-s1_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libgcc-s1:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Setting up libgcc-s1:ppc64el (10.2.1-1ubuntu1) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../00-libgomp1_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libgomp1:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../01-libitm1_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libitm1:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../02-libatomic1_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libatomic1:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../03-libasan6_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libasan6:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../04-liblsan0_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking liblsan0:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../05-libtsan0_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libtsan0:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../06-libubsan1_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libubsan1:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../07-libquadmath0_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libquadmath0:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../08-g++-10_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking g++-10 (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../09-libstdc++-10-dev_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libstdc++-10-dev:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../10-libgcc-10-dev_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libgcc-10-dev:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../11-gcc-10_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking gcc-10 (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../12-cpp-10_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking cpp-10 (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../13-libstdc++6_10.2.1-1ubuntu1_ppc64el.deb ... Unpacking libstdc++6:ppc64el (10.2.1-1ubuntu1) over (10.2.0-13ubuntu1) ... Setting up libstdc++6:ppc64el (10.2.1-1ubuntu1) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../0-libmpc3_1.2.0-1_ppc64el.deb ... Unpacking libmpc3:ppc64el (1.2.0-1) over (1.2.0~rc1-1) ... Preparing to unpack .../1-libctf0_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking libctf0:ppc64el (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../2-libctf-nobfd0_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking libctf-nobfd0:ppc64el (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../3-libbinutils_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking libbinutils:ppc64el (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../4-binutils-common_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking binutils-common:ppc64el (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../5-binutils_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking binutils (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../6-binutils-powerpc64le-linux-gnu_2.35.50.20201210-0ubuntu2_ppc64el.deb ... Unpacking binutils-powerpc64le-linux-gnu (2.35.50.20201210-0ubuntu2) over (2.35.1-1ubuntu1) ... Preparing to unpack .../7-libc6_2.32-0ubuntu5_ppc64el.deb ... Unpacking libc6:ppc64el (2.32-0ubuntu5) over (2.32-0ubuntu3) ... Setting up libc6:ppc64el (2.32-0ubuntu5) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../base-files_11ubuntu16_ppc64el.deb ... Unpacking base-files (11ubuntu16) over (11ubuntu14) ... Setting up base-files (11ubuntu16) ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../bash_5.1-1ubuntu1_ppc64el.deb ... Unpacking bash (5.1-1ubuntu1) over (5.0-6ubuntu2) ... Setting up bash (5.1-1ubuntu1) ... update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../bsdutils_1%3a2.36.1-1ubuntu2_ppc64el.deb ... Unpacking bsdutils (1:2.36.1-1ubuntu2) over (1:2.36-3ubuntu1) ... Setting up bsdutils (1:2.36.1-1ubuntu2) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../coreutils_8.32-4ubuntu2_ppc64el.deb ... Unpacking coreutils (8.32-4ubuntu2) over (8.32-3ubuntu1) ... Setting up coreutils (8.32-4ubuntu2) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../tar_1.32+dfsg-1_ppc64el.deb ... Unpacking tar (1.32+dfsg-1) over (1.30+dfsg-7) ... Setting up tar (1.32+dfsg-1) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../dpkg_1.20.5ubuntu3_ppc64el.deb ... Unpacking dpkg (1.20.5ubuntu3) over (1.20.5ubuntu2) ... Setting up dpkg (1.20.5ubuntu3) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../dash_0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1_ppc64el.deb ... Unpacking dash (0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1) over (0.5.10.2-7) ... Setting up dash (0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1) ... (Reading database ... 12927 files and directories currently installed.) Preparing to unpack .../grep_3.6-1_ppc64el.deb ... Unpacking grep (3.6-1) over (3.4-1) ... Setting up grep (3.6-1) ... (Reading database ... 12928 files and directories currently installed.) Preparing to unpack .../login_1%3a4.8.1-1ubuntu7_ppc64el.deb ... Unpacking login (1:4.8.1-1ubuntu7) over (1:4.8.1-1ubuntu6) ... Setting up login (1:4.8.1-1ubuntu7) ... (Reading database ... 12928 files and directories currently installed.) Preparing to unpack .../libncurses6_6.2+20201114-1_ppc64el.deb ... Unpacking libncurses6:ppc64el (6.2+20201114-1) over (6.2-1) ... Preparing to unpack .../libncursesw6_6.2+20201114-1_ppc64el.deb ... Unpacking libncursesw6:ppc64el (6.2+20201114-1) over (6.2-1) ... Preparing to unpack .../libtinfo6_6.2+20201114-1_ppc64el.deb ... Unpacking libtinfo6:ppc64el (6.2+20201114-1) over (6.2-1) ... Setting up libtinfo6:ppc64el (6.2+20201114-1) ... (Reading database ... 12928 files and directories currently installed.) Preparing to unpack .../ncurses-bin_6.2+20201114-1_ppc64el.deb ... Unpacking ncurses-bin (6.2+20201114-1) over (6.2-1) ... Setting up ncurses-bin (6.2+20201114-1) ... (Reading database ... 12928 files and directories currently installed.) Preparing to unpack .../perl_5.32.0-5_ppc64el.deb ... Unpacking perl (5.32.0-5) over (5.30.3-4) ... Selecting previously unselected package perl-modules-5.32. Preparing to unpack .../perl-modules-5.32_5.32.0-5_all.deb ... Unpacking perl-modules-5.32 (5.32.0-5) ... Selecting previously unselected package libperl5.32:ppc64el. Preparing to unpack .../libperl5.32_5.32.0-5_ppc64el.deb ... Unpacking libperl5.32:ppc64el (5.32.0-5) ... Preparing to unpack .../perl-base_5.32.0-5_ppc64el.deb ... Unpacking perl-base (5.32.0-5) over (5.30.3-4) ... Setting up perl-base (5.32.0-5) ... (Reading database ... 14850 files and directories currently installed.) Preparing to unpack .../util-linux_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking util-linux (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Setting up util-linux (2.36.1-1ubuntu2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libdebconfclient0_0.255ubuntu1_ppc64el.deb ... Unpacking libdebconfclient0:ppc64el (0.255ubuntu1) over (0.252ubuntu1) ... Setting up libdebconfclient0:ppc64el (0.255ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../base-passwd_3.5.48_ppc64el.deb ... Unpacking base-passwd (3.5.48) over (3.5.47) ... Setting up base-passwd (3.5.48) ... Changing home-directory of irc from /var/run/ircd to /run/ircd 1 changes have been made, rewriting files Writing passwd-file to /etc/passwd Writing shadow-file to /etc/shadow Writing group-file to /etc/group (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../init-system-helpers_1.59_all.deb ... Unpacking init-system-helpers (1.59) over (1.58) ... Setting up init-system-helpers (1.59) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libc-bin_2.32-0ubuntu5_ppc64el.deb ... Unpacking libc-bin (2.32-0ubuntu5) over (2.32-0ubuntu3) ... Setting up libc-bin (2.32-0ubuntu5) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../ncurses-base_6.2+20201114-1_all.deb ... Unpacking ncurses-base (6.2+20201114-1) over (6.2-1) ... Setting up ncurses-base (6.2+20201114-1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../sysvinit-utils_2.96-5ubuntu1_ppc64el.deb ... Unpacking sysvinit-utils (2.96-5ubuntu1) over (2.96-3ubuntu1) ... Setting up sysvinit-utils (2.96-5ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libgcrypt20_1.8.7-2ubuntu1_ppc64el.deb ... Unpacking libgcrypt20:ppc64el (1.8.7-2ubuntu1) over (1.8.5-5ubuntu2) ... Setting up libgcrypt20:ppc64el (1.8.7-2ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../liblz4-1_1.9.3-0ubuntu1_ppc64el.deb ... Unpacking liblz4-1:ppc64el (1.9.3-0ubuntu1) over (1.9.2-2) ... Setting up liblz4-1:ppc64el (1.9.3-0ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../systemd-sysv_246.6-5ubuntu1_ppc64el.deb ... Unpacking systemd-sysv (246.6-5ubuntu1) over (246.6-1ubuntu1) ... Preparing to unpack .../libaudit-common_1%3a2.8.5-3ubuntu3_all.deb ... Unpacking libaudit-common (1:2.8.5-3ubuntu3) over (1:2.8.5-3ubuntu1) ... Setting up libaudit-common (1:2.8.5-3ubuntu3) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libcap-ng0_0.7.9-2.2build1_ppc64el.deb ... Unpacking libcap-ng0:ppc64el (0.7.9-2.2build1) over (0.7.9-2.2) ... Setting up libcap-ng0:ppc64el (0.7.9-2.2build1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a2.8.5-3ubuntu3_ppc64el.deb ... Unpacking libaudit1:ppc64el (1:2.8.5-3ubuntu3) over (1:2.8.5-3ubuntu1) ... Setting up libaudit1:ppc64el (1:2.8.5-3ubuntu3) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libpcre2-8-0_10.35-2ubuntu1_ppc64el.deb ... Unpacking libpcre2-8-0:ppc64el (10.35-2ubuntu1) over (10.34-7) ... Setting up libpcre2-8-0:ppc64el (10.35-2ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libselinux1_3.1-2build2_ppc64el.deb ... Unpacking libselinux1:ppc64el (3.1-2build2) over (3.1-2) ... Setting up libselinux1:ppc64el (3.1-2build2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libsemanage-common_3.1-1build2_all.deb ... Unpacking libsemanage-common (3.1-1build2) over (3.1-1) ... Setting up libsemanage-common (3.1-1build2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libsemanage1_3.1-1build2_ppc64el.deb ... Unpacking libsemanage1:ppc64el (3.1-1build2) over (3.1-1) ... Setting up libsemanage1:ppc64el (3.1-1build2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../passwd_1%3a4.8.1-1ubuntu7_ppc64el.deb ... Unpacking passwd (1:4.8.1-1ubuntu7) over (1:4.8.1-1ubuntu6) ... Setting up passwd (1:4.8.1-1ubuntu7) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../adduser_3.118ubuntu4_all.deb ... Unpacking adduser (3.118ubuntu4) over (3.118ubuntu2) ... Setting up adduser (3.118ubuntu4) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../systemd-timesyncd_246.6-5ubuntu1_ppc64el.deb ... Unpacking systemd-timesyncd (246.6-5ubuntu1) over (246.6-1ubuntu1) ... Preparing to unpack .../libapparmor1_3.0.0-0ubuntu5_ppc64el.deb ... Unpacking libapparmor1:ppc64el (3.0.0-0ubuntu5) over (3.0.0-0ubuntu1) ... Preparing to unpack .../libcap2_1%3a2.44-1_ppc64el.deb ... Unpacking libcap2:ppc64el (1:2.44-1) over (1:2.43-1) ... Preparing to unpack .../libblkid1_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking libblkid1:ppc64el (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Setting up libblkid1:ppc64el (2.36.1-1ubuntu2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libudev1_246.6-5ubuntu1_ppc64el.deb ... Unpacking libudev1:ppc64el (246.6-5ubuntu1) over (246.6-1ubuntu1) ... Setting up libudev1:ppc64el (246.6-5ubuntu1) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.167-1ubuntu4_ppc64el.deb ... Unpacking libdevmapper1.02.1:ppc64el (2:1.02.167-1ubuntu4) over (2:1.02.167-1ubuntu3) ... Preparing to unpack .../libuuid1_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking libuuid1:ppc64el (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Setting up libuuid1:ppc64el (2.36.1-1ubuntu2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libcryptsetup12_2%3a2.3.4-1ubuntu1_ppc64el.deb ... Unpacking libcryptsetup12:ppc64el (2:2.3.4-1ubuntu1) over (2:2.3.3-1ubuntu6) ... Preparing to unpack .../libidn2-0_2.3.0-4_ppc64el.deb ... Unpacking libidn2-0:ppc64el (2.3.0-4) over (2.3.0-1) ... Setting up libidn2-0:ppc64el (2.3.0-4) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libip4tc2_1.8.5-3ubuntu4_ppc64el.deb ... Unpacking libip4tc2:ppc64el (1.8.5-3ubuntu4) over (1.8.5-3ubuntu1) ... Preparing to unpack .../libmount1_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking libmount1:ppc64el (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Setting up libmount1:ppc64el (2.36.1-1ubuntu2) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../libseccomp2_2.4.3-1ubuntu6_ppc64el.deb ... Unpacking libseccomp2:ppc64el (2.4.3-1ubuntu6) over (2.4.3-1ubuntu4) ... Setting up libseccomp2:ppc64el (2.4.3-1ubuntu6) ... (Reading database ... 14851 files and directories currently installed.) Preparing to unpack .../mount_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking mount (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Preparing to unpack .../systemd_246.6-5ubuntu1_ppc64el.deb ... Unpacking systemd (246.6-5ubuntu1) over (246.6-1ubuntu1) ... Preparing to unpack .../libsystemd0_246.6-5ubuntu1_ppc64el.deb ... Unpacking libsystemd0:ppc64el (246.6-5ubuntu1) over (246.6-1ubuntu1) ... Setting up libsystemd0:ppc64el (246.6-5ubuntu1) ... (Reading database ... 14852 files and directories currently installed.) Preparing to unpack .../libapt-pkg6.0_2.1.13_ppc64el.deb ... Unpacking libapt-pkg6.0:ppc64el (2.1.13) over (2.1.10) ... Setting up libapt-pkg6.0:ppc64el (2.1.13) ... (Reading database ... 14852 files and directories currently installed.) Preparing to unpack .../apt_2.1.13_ppc64el.deb ... Unpacking apt (2.1.13) over (2.1.10) ... Setting up apt (2.1.13) ... Setting up libapparmor1:ppc64el (3.0.0-0ubuntu5) ... Setting up libcap2:ppc64el (1:2.44-1) ... Setting up libdevmapper1.02.1:ppc64el (2:1.02.167-1ubuntu4) ... Setting up libssl1.1:ppc64el (1.1.1f-1ubuntu5) ... Setting up libcryptsetup12:ppc64el (2:2.3.4-1ubuntu1) ... Setting up libip4tc2:ppc64el (1.8.5-3ubuntu4) ... Setting up mount (2.36.1-1ubuntu2) ... Setting up systemd-timesyncd (246.6-5ubuntu1) ... Setting up systemd (246.6-5ubuntu1) ... Installing new version of config file /etc/systemd/system.conf ... Initializing machine ID from random generator. Removing obsolete conffile /etc/pam.d/systemd-user ... Setting up systemd-sysv (246.6-5ubuntu1) ... (Reading database ... 14856 files and directories currently installed.) Preparing to unpack .../archives/init_1.59_ppc64el.deb ... Unpacking init (1.59) over (1.58) ... Preparing to unpack .../libsmartcols1_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking libsmartcols1:ppc64el (2.36.1-1ubuntu2) over (2.36-3ubuntu1) ... Setting up libsmartcols1:ppc64el (2.36.1-1ubuntu2) ... (Reading database ... 14856 files and directories currently installed.) Preparing to unpack .../0-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) over (8.0-4) ... Preparing to unpack .../1-libreadline8_8.1-1_ppc64el.deb ... Unpacking libreadline8:ppc64el (8.1-1) over (8.0-4) ... Preparing to unpack .../2-libsqlite3-0_3.34.0-1_ppc64el.deb ... Unpacking libsqlite3-0:ppc64el (3.34.0-1) over (3.33.0-1) ... Preparing to unpack .../3-openssl_1.1.1f-1ubuntu5_ppc64el.deb ... Unpacking openssl (1.1.1f-1ubuntu5) over (1.1.1f-1ubuntu4) ... Preparing to unpack .../4-tzdata_2020d-1ubuntu1_all.deb ... Unpacking tzdata (2020d-1ubuntu1) over (2020b-1ubuntu1) ... Preparing to unpack .../5-dpkg-dev_1.20.5ubuntu3_all.deb ... Unpacking dpkg-dev (1.20.5ubuntu3) over (1.20.5ubuntu2) ... Preparing to unpack .../6-libdpkg-perl_1.20.5ubuntu3_all.deb ... Unpacking libdpkg-perl (1.20.5ubuntu3) over (1.20.5ubuntu2) ... Preparing to unpack .../7-libfakeroot_1.25.3-1.1_ppc64el.deb ... Unpacking libfakeroot:ppc64el (1.25.3-1.1) over (1.25.2-1) ... Preparing to unpack .../8-fakeroot_1.25.3-1.1_ppc64el.deb ... Unpacking fakeroot (1.25.3-1.1) over (1.25.2-1) ... Preparing to unpack .../9-libnpth0_1.6-3_ppc64el.deb ... Unpacking libnpth0:ppc64el (1.6-3) over (1.6-2) ... Setting up init (1.59) ... Setting up libtirpc-common (1.2.6-3) ... Setting up perl-modules-5.32 (5.32.0-5) ... Setting up libsqlite3-0:ppc64el (3.34.0-1) ... Setting up binutils-common:ppc64el (2.35.50.20201210-0ubuntu2) ... Setting up linux-libc-dev:ppc64el (5.8.0-32.34+21.04.1) ... Setting up libctf-nobfd0:ppc64el (2.35.50.20201210-0ubuntu2) ... Setting up libnpth0:ppc64el (1.6-3) ... Setting up libgomp1:ppc64el (10.2.1-1ubuntu1) ... Setting up libfakeroot:ppc64el (1.25.3-1.1) ... Setting up libasan6:ppc64el (10.2.1-1ubuntu1) ... Setting up libkrb5support0:ppc64el (1.17-10ubuntu1) ... Setting up tzdata (2020d-1ubuntu1) ... Current default time zone: 'Etc/UTC' Local time is now: Sat Dec 12 12:34:55 UTC 2020. Universal Time is now: Sat Dec 12 12:34:55 UTC 2020. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up fakeroot (1.25.3-1.1) ... Setting up libncurses6:ppc64el (6.2+20201114-1) ... Setting up libquadmath0:ppc64el (10.2.1-1ubuntu1) ... Setting up libmpc3:ppc64el (1.2.0-1) ... Setting up libatomic1:ppc64el (10.2.1-1ubuntu1) ... Setting up libncursesw6:ppc64el (6.2+20201114-1) ... Setting up libk5crypto3:ppc64el (1.17-10ubuntu1) ... Setting up libperl5.32:ppc64el (5.32.0-5) ... Setting up libubsan1:ppc64el (10.2.1-1ubuntu1) ... Setting up libcrypt-dev:ppc64el (1:4.4.17-1ubuntu1) ... Setting up libkrb5-3:ppc64el (1.17-10ubuntu1) ... Setting up libbinutils:ppc64el (2.35.50.20201210-0ubuntu2) ... Setting up libisl23:ppc64el (0.23-1) ... Setting up libc-dev-bin (2.32-0ubuntu5) ... Setting up openssl (1.1.1f-1ubuntu5) ... Setting up readline-common (8.1-1) ... Setting up libcc1-0:ppc64el (10.2.1-1ubuntu1) ... Setting up liblsan0:ppc64el (10.2.1-1ubuntu1) ... Setting up cpp-10 (10.2.1-1ubuntu1) ... Setting up libitm1:ppc64el (10.2.1-1ubuntu1) ... Setting up libtsan0:ppc64el (10.2.1-1ubuntu1) ... Setting up libctf0:ppc64el (2.35.50.20201210-0ubuntu2) ... Setting up libgcc-10-dev:ppc64el (10.2.1-1ubuntu1) ... Setting up libreadline8:ppc64el (8.1-1) ... Setting up perl (5.32.0-5) ... Setting up libgssapi-krb5-2:ppc64el (1.17-10ubuntu1) ... Setting up libdpkg-perl (1.20.5ubuntu3) ... Setting up binutils-powerpc64le-linux-gnu (2.35.50.20201210-0ubuntu2) ... Setting up libtirpc3:ppc64el (1.2.6-3) ... Setting up binutils (2.35.50.20201210-0ubuntu2) ... Setting up dpkg-dev (1.20.5ubuntu3) ... Setting up libtirpc-dev:ppc64el (1.2.6-3) ... Setting up gcc-10 (10.2.1-1ubuntu1) ... Setting up libc6-dev:ppc64el (2.32-0ubuntu5) ... Setting up libstdc++-10-dev:ppc64el (10.2.1-1ubuntu1) ... Setting up g++-10 (10.2.1-1ubuntu1) ... Processing triggers for libc-bin (2.32-0ubuntu5) ... RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-20400304 ppc64el hirsute-proposed -c chroot:build-PACKAGEBUILD-20400304 --arch=ppc64el --dist=hirsute-proposed --nolog ataqv_1.2.1+ds-1build1.dsc Initiating build PACKAGEBUILD-20400304 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 4.15.0-128-generic #131-Ubuntu SMP Wed Dec 9 06:54:14 UTC 2020 ppc64le sbuild (Debian sbuild) 0.75.0 (21 Mar 2018) on bos02-ppc64el-019.buildd +==============================================================================+ | ataqv 1.2.1+ds-1build1 (ppc64el) Sat, 12 Dec 2020 12:34:56 +0000 | +==============================================================================+ Package: ataqv Version: 1.2.1+ds-1build1 Source Version: 1.2.1+ds-1build1 Distribution: hirsute-proposed Machine Architecture: ppc64el Host Architecture: ppc64el Build Architecture: ppc64el Build Type: any I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-20400304/chroot-autobuild' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- ataqv_1.2.1+ds-1build1.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/ataqv-yl6LaK/ataqv-1.2.1+ds' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-yl6LaK' with '<>' +------------------------------------------------------------------------------+ | Install build-essential | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<>/resolver-krSTLX/apt_archive/sbuild-build-depends-core-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 1 entries to output Packages file. Ign:1 copy:/<>/resolver-krSTLX/apt_archive ./ InRelease Get:2 copy:/<>/resolver-krSTLX/apt_archive ./ Release [957 B] Ign:3 copy:/<>/resolver-krSTLX/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-krSTLX/apt_archive ./ Sources [349 B] Get:5 copy:/<>/resolver-krSTLX/apt_archive ./ Packages [434 B] Fetched 1740 B in 0s (81.0 kB/s) Reading package lists... Reading package lists... Install core build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: libisl22 libperl5.30 perl-modules-5.30 Use 'apt autoremove' to remove them. The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 856 B of archives. After this operation, 0 B of additional disk space will be used. Get:1 copy:/<>/resolver-krSTLX/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [856 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 856 B in 0s (0 B/s) Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... 14856 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_ppc64el.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (ppc64el included in any) +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 dpkg-deb: building package 'sbuild-build-depends-ataqv-dummy' in '/<>/resolver-krSTLX/apt_archive/sbuild-build-depends-ataqv-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-ataqv-dummy sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 2 entries to output Packages file. Ign:1 copy:/<>/resolver-krSTLX/apt_archive ./ InRelease Get:2 copy:/<>/resolver-krSTLX/apt_archive ./ Release [963 B] Ign:3 copy:/<>/resolver-krSTLX/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-krSTLX/apt_archive ./ Sources [615 B] Get:5 copy:/<>/resolver-krSTLX/apt_archive ./ Packages [700 B] Fetched 2278 B in 0s (84.5 kB/s) Reading package lists... Reading package lists... Install ataqv build dependencies (apt-based resolver) ----------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: libisl22 libperl5.30 perl-modules-5.30 Use 'apt autoremove' to remove them. The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libasn1-8-heimdal libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcroco3 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libgssapi3-heimdal libhcrypto4-heimdal libheimbase1-heimdal libheimntlm0-heimdal libhts-dev libhts3 libhx509-5-heimdal libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libkrb5-26-heimdal libldap-2.4-2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 libpython3-stdlib libpython3.9-minimal libpython3.9-stdlib libroken18-heimdal librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libwind0-heimdal libxml2 m4 mailcap man-db media-types mime-support node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv node-jquery node-normalize.css node-rw nodejs po-debconf python3 python3-minimal python3.9 python3.9-minimal zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libboost1.74-doc libboost-atomic1.74-dev libboost-container1.74-dev libboost-context1.74-dev libboost-contract1.74-dev libboost-coroutine1.74-dev libboost-date-time1.74-dev libboost-exception1.74-dev libboost-fiber1.74-dev libboost-graph1.74-dev libboost-graph-parallel1.74-dev libboost-locale1.74-dev libboost-log1.74-dev libboost-math1.74-dev libboost-mpi1.74-dev libboost-mpi-python1.74-dev libboost-numpy1.74-dev libboost-program-options1.74-dev libboost-python1.74-dev libboost-random1.74-dev libboost-serialization1.74-dev libboost-stacktrace1.74-dev libboost-test1.74-dev libboost-thread1.74-dev libboost-timer1.74-dev libboost-type-erasure1.74-dev libboost-wave1.74-dev libboost1.74-tools-dev libmpfrc++-dev libntl-dev libboost-nowide1.74-dev libcurl4-doc libgnutls28-dev libidn11-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libjs-html5shiv npm libmail-box-perl python3-doc python3-tk python3-venv python3.9-venv python3.9-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs javascript-common libldap-common publicsuffix libsasl2-modules libltdl-dev libjs-sizzle nodejs-doc libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libasn1-8-heimdal libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcroco3 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libgssapi3-heimdal libhcrypto4-heimdal libheimbase1-heimdal libheimntlm0-heimdal libhts-dev libhts3 libhx509-5-heimdal libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libkrb5-26-heimdal libldap-2.4-2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 libpython3-stdlib libpython3.9-minimal libpython3.9-stdlib libroken18-heimdal librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libwind0-heimdal libxml2 m4 mailcap man-db media-types mime-support node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv node-jquery node-normalize.css node-rw nodejs po-debconf python3 python3-minimal python3.9 python3.9-minimal sbuild-build-depends-ataqv-dummy zlib1g-dev 0 upgraded, 136 newly installed, 0 to remove and 0 not upgraded. Need to get 71.8 MB of archives. After this operation, 405 MB of additional disk space will be used. Get:1 copy:/<>/resolver-krSTLX/apt_archive ./ sbuild-build-depends-ataqv-dummy 0.invalid.0 [988 B] Get:2 http://ftpmaster.internal/ubuntu hirsute/main ppc64el liblocale-gettext-perl ppc64el 1.07-4build1 [17.2 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libpython3.9-minimal ppc64el 3.9.1-1 [749 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libexpat1 ppc64el 2.2.10-1 [77.6 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el python3.9-minimal ppc64el 3.9.1-1 [1829 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main ppc64el python3-minimal ppc64el 3.9.0-3ubuntu1 [24.0 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/main ppc64el media-types all 1.0.1ubuntu1 [10.9 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute/main ppc64el mailcap all 3.67ubuntu1 [24.2 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute/main ppc64el mime-support all 3.66 [3696 B] Get:10 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libpython3.9-stdlib ppc64el 3.9.1-1 [1754 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el python3.9 ppc64el 3.9.1-1 [414 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libpython3-stdlib ppc64el 3.9.0-3ubuntu1 [7292 B] Get:13 http://ftpmaster.internal/ubuntu hirsute/main ppc64el python3 ppc64el 3.9.0-3ubuntu1 [48.8 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute/main ppc64el bsdextrautils ppc64el 2.36.1-1ubuntu2 [83.5 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libuchardet0 ppc64el 0.0.7-1 [71.0 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute/main ppc64el groff-base ppc64el 1.22.4-5 [922 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libpipeline1 ppc64el 1.5.3-1 [29.6 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute/main ppc64el man-db ppc64el 2.9.3-2 [1148 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-normalize.css all 8.0.1-3 [10.3 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libmagic-mgc ppc64el 1:5.39-3 [228 kB] Get:21 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libmagic1 ppc64el 1:5.39-3 [93.4 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute/main ppc64el file ppc64el 1:5.39-3 [24.7 kB] Get:23 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libelf1 ppc64el 0.182-1 [52.3 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libglib2.0-0 ppc64el 2.66.3-2 [1408 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libicu67 ppc64el 67.1-5 [8813 kB] Get:26 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libxml2 ppc64el 2.9.10+dfsg-6.3build1 [656 kB] Get:27 http://ftpmaster.internal/ubuntu hirsute/main ppc64el gettext-base ppc64el 0.19.8.1-10build1 [52.5 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libpsl5 ppc64el 0.21.0-1.1ubuntu1 [54.0 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsigsegv2 ppc64el 2.12-2build1 [14.4 kB] Get:30 http://ftpmaster.internal/ubuntu hirsute/main ppc64el m4 ppc64el 1.4.18-4 [210 kB] Get:31 http://ftpmaster.internal/ubuntu hirsute/main ppc64el autoconf all 2.69-11.1 [321 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute/main ppc64el autotools-dev all 20180224.1 [39.6 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute/main ppc64el automake all 1:1.16.3-1ubuntu1 [552 kB] Get:34 http://ftpmaster.internal/ubuntu hirsute/main ppc64el autopoint all 0.19.8.1-10build1 [412 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libtool all 2.4.6-14 [161 kB] Get:36 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dh-autoreconf all 19 [16.1 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libdebhelper-perl all 13.3ubuntu1 [64.1 kB] Get:38 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libarchive-zip-perl all 1.68-1 [90.2 kB] Get:39 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsub-override-perl all 0.09-2 [9532 B] Get:40 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libfile-stripnondeterminism-perl all 1.9.0-1 [17.2 kB] Get:41 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dh-strip-nondeterminism all 1.9.0-1 [5192 B] Get:42 http://ftpmaster.internal/ubuntu hirsute/main ppc64el dwz ppc64el 0.13+20201015-2 [156 kB] Get:43 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcroco3 ppc64el 0.6.13-1 [92.1 kB] Get:44 http://ftpmaster.internal/ubuntu hirsute/main ppc64el gettext ppc64el 0.19.8.1-10build1 [959 kB] Get:45 http://ftpmaster.internal/ubuntu hirsute/main ppc64el intltool-debian all 0.35.0+20060710.5 [24.9 kB] Get:46 http://ftpmaster.internal/ubuntu hirsute/main ppc64el po-debconf all 1.0.21 [233 kB] Get:47 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el debhelper all 13.3ubuntu1 [881 kB] Get:48 http://ftpmaster.internal/ubuntu hirsute/main ppc64el fonts-font-awesome all 5.0.10+really4.7.0~dfsg-2 [514 kB] Get:49 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el help2man ppc64el 1.47.16 [174 kB] Get:50 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el icu-devtools ppc64el 67.1-5 [210 kB] Get:51 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libroken18-heimdal ppc64el 7.7.0+dfsg-2 [46.4 kB] Get:52 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libasn1-8-heimdal ppc64el 7.7.0+dfsg-2 [176 kB] Get:53 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost1.74-dev ppc64el 1.74.0-3ubuntu1 [9507 kB] Get:54 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-chrono1.74.0 ppc64el 1.74.0-3ubuntu1 [227 kB] Get:55 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-chrono1.74-dev ppc64el 1.74.0-3ubuntu1 [231 kB] Get:56 http://ftpmaster.internal/ubuntu hirsute-proposed/universe ppc64el libboost-chrono-dev ppc64el 1.74.0.2ubuntu1 [3604 B] Get:57 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-filesystem1.74.0 ppc64el 1.74.0-3ubuntu1 [257 kB] Get:58 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-system1.74.0 ppc64el 1.74.0-3ubuntu1 [216 kB] Get:59 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-system1.74-dev ppc64el 1.74.0-3ubuntu1 [213 kB] Get:60 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-filesystem1.74-dev ppc64el 1.74.0-3ubuntu1 [278 kB] Get:61 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libboost-filesystem-dev ppc64el 1.74.0.2ubuntu1 [3008 B] Get:62 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-regex1.74.0 ppc64el 1.74.0-3ubuntu1 [487 kB] Get:63 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libicu-dev ppc64el 67.1-5 [9990 kB] Get:64 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-regex1.74-dev ppc64el 1.74.0-3ubuntu1 [557 kB] Get:65 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-iostreams1.74.0 ppc64el 1.74.0-3ubuntu1 [237 kB] Get:66 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libboost-iostreams1.74-dev ppc64el 1.74.0-3ubuntu1 [242 kB] Get:67 http://ftpmaster.internal/ubuntu hirsute-proposed/universe ppc64el libboost-iostreams-dev ppc64el 1.74.0.2ubuntu1 [2960 B] Get:68 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libboost-system-dev ppc64el 1.74.0.2ubuntu1 [3120 B] Get:69 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libbrotli1 ppc64el 1.0.9-2build2 [304 kB] Get:70 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libheimbase1-heimdal ppc64el 7.7.0+dfsg-2 [32.4 kB] Get:71 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libhcrypto4-heimdal ppc64el 7.7.0+dfsg-2 [108 kB] Get:72 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libwind0-heimdal ppc64el 7.7.0+dfsg-2 [48.9 kB] Get:73 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libhx509-5-heimdal ppc64el 7.7.0+dfsg-2 [120 kB] Get:74 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libkrb5-26-heimdal ppc64el 7.7.0+dfsg-2 [234 kB] Get:75 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libheimntlm0-heimdal ppc64el 7.7.0+dfsg-2 [17.4 kB] Get:76 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libgssapi3-heimdal ppc64el 7.7.0+dfsg-2 [105 kB] Get:77 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsasl2-modules-db ppc64el 2.1.27+dfsg-2ubuntu1 [16.8 kB] Get:78 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libsasl2-2 ppc64el 2.1.27+dfsg-2ubuntu1 [60.0 kB] Get:79 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libldap-2.4-2 ppc64el 2.4.53+dfsg-1ubuntu5 [177 kB] Get:80 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libnghttp2-14 ppc64el 1.42.0-1 [83.7 kB] Get:81 http://ftpmaster.internal/ubuntu hirsute/main ppc64el librtmp1 ppc64el 2.4+20151223.gitfa8646d.1-2build2 [59.2 kB] Get:82 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libssh-4 ppc64el 0.9.5-1 [195 kB] Get:83 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcurl3-gnutls ppc64el 7.72.0-1ubuntu1 [259 kB] Get:84 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libcurl4-gnutls-dev ppc64el 7.72.0-1ubuntu1 [363 kB] Get:85 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libdeflate0 ppc64el 1.6-1 [64.0 kB] Get:86 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libdeflate-dev ppc64el 1.6-1 [48.0 kB] Get:87 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libhts3 ppc64el 1.11-2 [426 kB] Get:88 http://ftpmaster.internal/ubuntu hirsute/main ppc64el liblzma-dev ppc64el 5.2.4-1ubuntu1 [164 kB] Get:89 http://ftpmaster.internal/ubuntu hirsute/main ppc64el zlib1g-dev ppc64el 1:1.2.11.dfsg-2ubuntu4 [166 kB] Get:90 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libhts-dev ppc64el 1.11-2 [3963 kB] Get:91 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el node-jquery all 3.5.1+dfsg+~3.5.4-3 [396 kB] Get:92 http://ftpmaster.internal/ubuntu hirsute-proposed/main ppc64el libjs-jquery all 3.5.1+dfsg+~3.5.4-3 [2364 B] Get:93 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libjs-jquery-datatables all 1.10.21+dfsg-1 [137 kB] Get:94 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-4 [648 kB] Get:95 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libncurses-dev ppc64el 6.2+20201114-1 [419 kB] Get:96 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libncurses5-dev ppc64el 6.2+20201114-1 [992 B] Get:97 http://ftpmaster.internal/ubuntu hirsute/main ppc64el libc-ares2 ppc64el 1.17.1-1 [48.3 kB] Get:98 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libnode72 ppc64el 12.19.0~dfsg-1ubuntu1 [8776 kB] Get:99 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el nodejs ppc64el 12.19.0~dfsg-1ubuntu1 [33.6 kB] Get:100 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-array all 1.2.4-2 [23.5 kB] Get:101 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-axis all 1.0.12-2 [16.5 kB] Get:102 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-dispatch all 1.0.6-1 [7648 B] Get:103 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-selection all 1.4.0-5 [31.2 kB] Get:104 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-drag all 1.2.5-1 [13.8 kB] Get:105 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-color all 1.2.8-1 [14.9 kB] Get:106 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-interpolate all 1.4.0-1 [18.5 kB] Get:107 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-ease all 1.0.5-2 [320 kB] Get:108 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-timer all 1.0.9-2 [8428 B] Get:109 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-transition all 1.2.0-4 [22.0 kB] Get:110 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-brush all 1.1.5-1 [177 kB] Get:111 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-path all 1.0.9-1 [8004 B] Get:112 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-chord all 1.0.6-2 [124 kB] Get:113 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-collection all 1.0.7-2 [11.6 kB] Get:114 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-contour all 1.3.2-3 [5612 kB] Get:115 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-iconv ppc64el 2.3.5-5 [121 kB] Get:116 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-queue all 3.0.7-10 [9336 B] Get:117 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-rw all 1.3.3-2 [7136 B] Get:118 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-commander all 4.1.1-3 [28.1 kB] Get:119 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-dsv all 1.1.1-2 [14.1 kB] Get:120 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-fetch all 1.1.2+dfsg-2 [15.8 kB] Get:121 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-quadtree all 1.0.7-1 [12.9 kB] Get:122 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-force all 1.2.1-2 [363 kB] Get:123 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el libjs-d3-format all 1:1.4.1-2 [16.8 kB] Get:124 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-format all 1:1.4.1-2 [7584 B] Get:125 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-geo all 1.11.9-1 [54.7 kB] Get:126 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-hierarchy all 1.1.8-2 [286 kB] Get:127 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-polygon all 1.0.5-2 [14.2 kB] Get:128 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-random all 1.1.2-2 [6992 B] Get:129 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-time all 1.0.11-3 [14.5 kB] Get:130 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-time-format all 2.1.3-2 [18.9 kB] Get:131 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-scale all 2.2.2-2 [49.1 kB] Get:132 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-scale-chromatic all 1.5.0-1 [18.4 kB] Get:133 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-shape all 1.3.7-1 [40.8 kB] Get:134 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-voronoi all 1.1.4-2 [17.4 kB] Get:135 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3-zoom all 1.8.3-1 [227 kB] Get:136 http://ftpmaster.internal/ubuntu hirsute/universe ppc64el node-d3 all 5.16.0-1 [179 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 71.8 MB in 6s (13.0 MB/s) Selecting previously unselected package liblocale-gettext-perl. (Reading database ... 14856 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-4build1_ppc64el.deb ... Unpacking liblocale-gettext-perl (1.07-4build1) ... Selecting previously unselected package libpython3.9-minimal:ppc64el. Preparing to unpack .../libpython3.9-minimal_3.9.1-1_ppc64el.deb ... Unpacking libpython3.9-minimal:ppc64el (3.9.1-1) ... Selecting previously unselected package libexpat1:ppc64el. Preparing to unpack .../libexpat1_2.2.10-1_ppc64el.deb ... Unpacking libexpat1:ppc64el (2.2.10-1) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../python3.9-minimal_3.9.1-1_ppc64el.deb ... Unpacking python3.9-minimal (3.9.1-1) ... Setting up libpython3.9-minimal:ppc64el (3.9.1-1) ... Setting up libexpat1:ppc64el (2.2.10-1) ... Setting up python3.9-minimal (3.9.1-1) ... Selecting previously unselected package python3-minimal. (Reading database ... 15163 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.0-3ubuntu1_ppc64el.deb ... Unpacking python3-minimal (3.9.0-3ubuntu1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_1.0.1ubuntu1_all.deb ... Unpacking media-types (1.0.1ubuntu1) ... Selecting previously unselected package mailcap. Preparing to unpack .../2-mailcap_3.67ubuntu1_all.deb ... Unpacking mailcap (3.67ubuntu1) ... Selecting previously unselected package mime-support. Preparing to unpack .../3-mime-support_3.66_all.deb ... Unpacking mime-support (3.66) ... Selecting previously unselected package libpython3.9-stdlib:ppc64el. Preparing to unpack .../4-libpython3.9-stdlib_3.9.1-1_ppc64el.deb ... Unpacking libpython3.9-stdlib:ppc64el (3.9.1-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../5-python3.9_3.9.1-1_ppc64el.deb ... Unpacking python3.9 (3.9.1-1) ... Selecting previously unselected package libpython3-stdlib:ppc64el. Preparing to unpack .../6-libpython3-stdlib_3.9.0-3ubuntu1_ppc64el.deb ... Unpacking libpython3-stdlib:ppc64el (3.9.0-3ubuntu1) ... Setting up python3-minimal (3.9.0-3ubuntu1) ... Selecting previously unselected package python3. (Reading database ... 15577 files and directories currently installed.) Preparing to unpack .../000-python3_3.9.0-3ubuntu1_ppc64el.deb ... Unpacking python3 (3.9.0-3ubuntu1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../001-bsdextrautils_2.36.1-1ubuntu2_ppc64el.deb ... Unpacking bsdextrautils (2.36.1-1ubuntu2) ... Selecting previously unselected package libuchardet0:ppc64el. Preparing to unpack .../002-libuchardet0_0.0.7-1_ppc64el.deb ... Unpacking libuchardet0:ppc64el (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../003-groff-base_1.22.4-5_ppc64el.deb ... Unpacking groff-base (1.22.4-5) ... Selecting previously unselected package libpipeline1:ppc64el. Preparing to unpack .../004-libpipeline1_1.5.3-1_ppc64el.deb ... Unpacking libpipeline1:ppc64el (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../005-man-db_2.9.3-2_ppc64el.deb ... Unpacking man-db (2.9.3-2) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../006-node-normalize.css_8.0.1-3_all.deb ... Unpacking node-normalize.css (8.0.1-3) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../007-libmagic-mgc_1%3a5.39-3_ppc64el.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:ppc64el. Preparing to unpack .../008-libmagic1_1%3a5.39-3_ppc64el.deb ... Unpacking libmagic1:ppc64el (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../009-file_1%3a5.39-3_ppc64el.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package libelf1:ppc64el. Preparing to unpack .../010-libelf1_0.182-1_ppc64el.deb ... Unpacking libelf1:ppc64el (0.182-1) ... Selecting previously unselected package libglib2.0-0:ppc64el. Preparing to unpack .../011-libglib2.0-0_2.66.3-2_ppc64el.deb ... Unpacking libglib2.0-0:ppc64el (2.66.3-2) ... Selecting previously unselected package libicu67:ppc64el. Preparing to unpack .../012-libicu67_67.1-5_ppc64el.deb ... Unpacking libicu67:ppc64el (67.1-5) ... Selecting previously unselected package libxml2:ppc64el. Preparing to unpack .../013-libxml2_2.9.10+dfsg-6.3build1_ppc64el.deb ... Unpacking libxml2:ppc64el (2.9.10+dfsg-6.3build1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../014-gettext-base_0.19.8.1-10build1_ppc64el.deb ... Unpacking gettext-base (0.19.8.1-10build1) ... Selecting previously unselected package libpsl5:ppc64el. Preparing to unpack .../015-libpsl5_0.21.0-1.1ubuntu1_ppc64el.deb ... Unpacking libpsl5:ppc64el (0.21.0-1.1ubuntu1) ... Selecting previously unselected package libsigsegv2:ppc64el. Preparing to unpack .../016-libsigsegv2_2.12-2build1_ppc64el.deb ... Unpacking libsigsegv2:ppc64el (2.12-2build1) ... Selecting previously unselected package m4. Preparing to unpack .../017-m4_1.4.18-4_ppc64el.deb ... Unpacking m4 (1.4.18-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../018-autoconf_2.69-11.1_all.deb ... Unpacking autoconf (2.69-11.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../019-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../020-automake_1%3a1.16.3-1ubuntu1_all.deb ... Unpacking automake (1:1.16.3-1ubuntu1) ... Selecting previously unselected package autopoint. Preparing to unpack .../021-autopoint_0.19.8.1-10build1_all.deb ... Unpacking autopoint (0.19.8.1-10build1) ... Selecting previously unselected package libtool. Preparing to unpack .../022-libtool_2.4.6-14_all.deb ... Unpacking libtool (2.4.6-14) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../023-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../024-libdebhelper-perl_13.3ubuntu1_all.deb ... Unpacking libdebhelper-perl (13.3ubuntu1) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../025-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../026-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../027-libfile-stripnondeterminism-perl_1.9.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.9.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../028-dh-strip-nondeterminism_1.9.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.9.0-1) ... Selecting previously unselected package dwz. Preparing to unpack .../029-dwz_0.13+20201015-2_ppc64el.deb ... Unpacking dwz (0.13+20201015-2) ... Selecting previously unselected package libcroco3:ppc64el. Preparing to unpack .../030-libcroco3_0.6.13-1_ppc64el.deb ... Unpacking libcroco3:ppc64el (0.6.13-1) ... Selecting previously unselected package gettext. Preparing to unpack .../031-gettext_0.19.8.1-10build1_ppc64el.deb ... Unpacking gettext (0.19.8.1-10build1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../032-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../033-po-debconf_1.0.21_all.deb ... Unpacking po-debconf (1.0.21) ... Selecting previously unselected package debhelper. Preparing to unpack .../034-debhelper_13.3ubuntu1_all.deb ... Unpacking debhelper (13.3ubuntu1) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../035-fonts-font-awesome_5.0.10+really4.7.0~dfsg-2_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-2) ... Selecting previously unselected package help2man. Preparing to unpack .../036-help2man_1.47.16_ppc64el.deb ... Unpacking help2man (1.47.16) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../037-icu-devtools_67.1-5_ppc64el.deb ... Unpacking icu-devtools (67.1-5) ... Selecting previously unselected package libroken18-heimdal:ppc64el. Preparing to unpack .../038-libroken18-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libroken18-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libasn1-8-heimdal:ppc64el. Preparing to unpack .../039-libasn1-8-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libasn1-8-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libboost1.74-dev:ppc64el. Preparing to unpack .../040-libboost1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-chrono1.74.0:ppc64el. Preparing to unpack .../041-libboost-chrono1.74.0_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-chrono1.74.0:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-chrono1.74-dev:ppc64el. Preparing to unpack .../042-libboost-chrono1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-chrono1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-chrono-dev:ppc64el. Preparing to unpack .../043-libboost-chrono-dev_1.74.0.2ubuntu1_ppc64el.deb ... Unpacking libboost-chrono-dev:ppc64el (1.74.0.2ubuntu1) ... Selecting previously unselected package libboost-filesystem1.74.0:ppc64el. Preparing to unpack .../044-libboost-filesystem1.74.0_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-filesystem1.74.0:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-system1.74.0:ppc64el. Preparing to unpack .../045-libboost-system1.74.0_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-system1.74.0:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-system1.74-dev:ppc64el. Preparing to unpack .../046-libboost-system1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-system1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-filesystem1.74-dev:ppc64el. Preparing to unpack .../047-libboost-filesystem1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-filesystem1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-filesystem-dev:ppc64el. Preparing to unpack .../048-libboost-filesystem-dev_1.74.0.2ubuntu1_ppc64el.deb ... Unpacking libboost-filesystem-dev:ppc64el (1.74.0.2ubuntu1) ... Selecting previously unselected package libboost-regex1.74.0:ppc64el. Preparing to unpack .../049-libboost-regex1.74.0_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-regex1.74.0:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libicu-dev:ppc64el. Preparing to unpack .../050-libicu-dev_67.1-5_ppc64el.deb ... Unpacking libicu-dev:ppc64el (67.1-5) ... Selecting previously unselected package libboost-regex1.74-dev:ppc64el. Preparing to unpack .../051-libboost-regex1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-regex1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-iostreams1.74.0:ppc64el. Preparing to unpack .../052-libboost-iostreams1.74.0_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-iostreams1.74.0:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-iostreams1.74-dev:ppc64el. Preparing to unpack .../053-libboost-iostreams1.74-dev_1.74.0-3ubuntu1_ppc64el.deb ... Unpacking libboost-iostreams1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Selecting previously unselected package libboost-iostreams-dev:ppc64el. Preparing to unpack .../054-libboost-iostreams-dev_1.74.0.2ubuntu1_ppc64el.deb ... Unpacking libboost-iostreams-dev:ppc64el (1.74.0.2ubuntu1) ... Selecting previously unselected package libboost-system-dev:ppc64el. Preparing to unpack .../055-libboost-system-dev_1.74.0.2ubuntu1_ppc64el.deb ... Unpacking libboost-system-dev:ppc64el (1.74.0.2ubuntu1) ... Selecting previously unselected package libbrotli1:ppc64el. Preparing to unpack .../056-libbrotli1_1.0.9-2build2_ppc64el.deb ... Unpacking libbrotli1:ppc64el (1.0.9-2build2) ... Selecting previously unselected package libheimbase1-heimdal:ppc64el. Preparing to unpack .../057-libheimbase1-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libheimbase1-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libhcrypto4-heimdal:ppc64el. Preparing to unpack .../058-libhcrypto4-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libhcrypto4-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libwind0-heimdal:ppc64el. Preparing to unpack .../059-libwind0-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libwind0-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libhx509-5-heimdal:ppc64el. Preparing to unpack .../060-libhx509-5-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libhx509-5-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libkrb5-26-heimdal:ppc64el. Preparing to unpack .../061-libkrb5-26-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libkrb5-26-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libheimntlm0-heimdal:ppc64el. Preparing to unpack .../062-libheimntlm0-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libheimntlm0-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libgssapi3-heimdal:ppc64el. Preparing to unpack .../063-libgssapi3-heimdal_7.7.0+dfsg-2_ppc64el.deb ... Unpacking libgssapi3-heimdal:ppc64el (7.7.0+dfsg-2) ... Selecting previously unselected package libsasl2-modules-db:ppc64el. Preparing to unpack .../064-libsasl2-modules-db_2.1.27+dfsg-2ubuntu1_ppc64el.deb ... Unpacking libsasl2-modules-db:ppc64el (2.1.27+dfsg-2ubuntu1) ... Selecting previously unselected package libsasl2-2:ppc64el. Preparing to unpack .../065-libsasl2-2_2.1.27+dfsg-2ubuntu1_ppc64el.deb ... Unpacking libsasl2-2:ppc64el (2.1.27+dfsg-2ubuntu1) ... Selecting previously unselected package libldap-2.4-2:ppc64el. Preparing to unpack .../066-libldap-2.4-2_2.4.53+dfsg-1ubuntu5_ppc64el.deb ... Unpacking libldap-2.4-2:ppc64el (2.4.53+dfsg-1ubuntu5) ... Selecting previously unselected package libnghttp2-14:ppc64el. Preparing to unpack .../067-libnghttp2-14_1.42.0-1_ppc64el.deb ... Unpacking libnghttp2-14:ppc64el (1.42.0-1) ... Selecting previously unselected package librtmp1:ppc64el. Preparing to unpack .../068-librtmp1_2.4+20151223.gitfa8646d.1-2build2_ppc64el.deb ... Unpacking librtmp1:ppc64el (2.4+20151223.gitfa8646d.1-2build2) ... Selecting previously unselected package libssh-4:ppc64el. Preparing to unpack .../069-libssh-4_0.9.5-1_ppc64el.deb ... Unpacking libssh-4:ppc64el (0.9.5-1) ... Selecting previously unselected package libcurl3-gnutls:ppc64el. Preparing to unpack .../070-libcurl3-gnutls_7.72.0-1ubuntu1_ppc64el.deb ... Unpacking libcurl3-gnutls:ppc64el (7.72.0-1ubuntu1) ... Selecting previously unselected package libcurl4-gnutls-dev:ppc64el. Preparing to unpack .../071-libcurl4-gnutls-dev_7.72.0-1ubuntu1_ppc64el.deb ... Unpacking libcurl4-gnutls-dev:ppc64el (7.72.0-1ubuntu1) ... Selecting previously unselected package libdeflate0:ppc64el. Preparing to unpack .../072-libdeflate0_1.6-1_ppc64el.deb ... Unpacking libdeflate0:ppc64el (1.6-1) ... Selecting previously unselected package libdeflate-dev:ppc64el. Preparing to unpack .../073-libdeflate-dev_1.6-1_ppc64el.deb ... Unpacking libdeflate-dev:ppc64el (1.6-1) ... Selecting previously unselected package libhts3:ppc64el. Preparing to unpack .../074-libhts3_1.11-2_ppc64el.deb ... Unpacking libhts3:ppc64el (1.11-2) ... Selecting previously unselected package liblzma-dev:ppc64el. Preparing to unpack .../075-liblzma-dev_5.2.4-1ubuntu1_ppc64el.deb ... Unpacking liblzma-dev:ppc64el (5.2.4-1ubuntu1) ... Selecting previously unselected package zlib1g-dev:ppc64el. Preparing to unpack .../076-zlib1g-dev_1%3a1.2.11.dfsg-2ubuntu4_ppc64el.deb ... Unpacking zlib1g-dev:ppc64el (1:1.2.11.dfsg-2ubuntu4) ... Selecting previously unselected package libhts-dev:ppc64el. Preparing to unpack .../077-libhts-dev_1.11-2_ppc64el.deb ... Unpacking libhts-dev:ppc64el (1.11-2) ... Selecting previously unselected package node-jquery. Preparing to unpack .../078-node-jquery_3.5.1+dfsg+~3.5.4-3_all.deb ... Unpacking node-jquery (3.5.1+dfsg+~3.5.4-3) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../079-libjs-jquery_3.5.1+dfsg+~3.5.4-3_all.deb ... Unpacking libjs-jquery (3.5.1+dfsg+~3.5.4-3) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../080-libjs-jquery-datatables_1.10.21+dfsg-1_all.deb ... Unpacking libjs-jquery-datatables (1.10.21+dfsg-1) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../081-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-4_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-4) ... Selecting previously unselected package libncurses-dev:ppc64el. Preparing to unpack .../082-libncurses-dev_6.2+20201114-1_ppc64el.deb ... Unpacking libncurses-dev:ppc64el (6.2+20201114-1) ... Selecting previously unselected package libncurses5-dev:ppc64el. Preparing to unpack .../083-libncurses5-dev_6.2+20201114-1_ppc64el.deb ... Unpacking libncurses5-dev:ppc64el (6.2+20201114-1) ... Selecting previously unselected package libc-ares2:ppc64el. Preparing to unpack .../084-libc-ares2_1.17.1-1_ppc64el.deb ... Unpacking libc-ares2:ppc64el (1.17.1-1) ... Selecting previously unselected package libnode72:ppc64el. Preparing to unpack .../085-libnode72_12.19.0~dfsg-1ubuntu1_ppc64el.deb ... Unpacking libnode72:ppc64el (12.19.0~dfsg-1ubuntu1) ... Selecting previously unselected package nodejs. Preparing to unpack .../086-nodejs_12.19.0~dfsg-1ubuntu1_ppc64el.deb ... Unpacking nodejs (12.19.0~dfsg-1ubuntu1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../087-node-d3-array_1.2.4-2_all.deb ... Unpacking node-d3-array (1.2.4-2) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../088-node-d3-axis_1.0.12-2_all.deb ... Unpacking node-d3-axis (1.0.12-2) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../089-node-d3-dispatch_1.0.6-1_all.deb ... Unpacking node-d3-dispatch (1.0.6-1) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../090-node-d3-selection_1.4.0-5_all.deb ... Unpacking node-d3-selection (1.4.0-5) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../091-node-d3-drag_1.2.5-1_all.deb ... Unpacking node-d3-drag (1.2.5-1) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../092-node-d3-color_1.2.8-1_all.deb ... Unpacking node-d3-color (1.2.8-1) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../093-node-d3-interpolate_1.4.0-1_all.deb ... Unpacking node-d3-interpolate (1.4.0-1) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../094-node-d3-ease_1.0.5-2_all.deb ... Unpacking node-d3-ease (1.0.5-2) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../095-node-d3-timer_1.0.9-2_all.deb ... Unpacking node-d3-timer (1.0.9-2) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../096-node-d3-transition_1.2.0-4_all.deb ... Unpacking node-d3-transition (1.2.0-4) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../097-node-d3-brush_1.1.5-1_all.deb ... Unpacking node-d3-brush (1.1.5-1) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../098-node-d3-path_1.0.9-1_all.deb ... Unpacking node-d3-path (1.0.9-1) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../099-node-d3-chord_1.0.6-2_all.deb ... Unpacking node-d3-chord (1.0.6-2) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../100-node-d3-collection_1.0.7-2_all.deb ... Unpacking node-d3-collection (1.0.7-2) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../101-node-d3-contour_1.3.2-3_all.deb ... Unpacking node-d3-contour (1.3.2-3) ... Selecting previously unselected package node-iconv:ppc64el. Preparing to unpack .../102-node-iconv_2.3.5-5_ppc64el.deb ... Unpacking node-iconv:ppc64el (2.3.5-5) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../103-node-d3-queue_3.0.7-10_all.deb ... Unpacking node-d3-queue (3.0.7-10) ... Selecting previously unselected package node-rw. Preparing to unpack .../104-node-rw_1.3.3-2_all.deb ... Unpacking node-rw (1.3.3-2) ... Selecting previously unselected package node-commander. Preparing to unpack .../105-node-commander_4.1.1-3_all.deb ... Unpacking node-commander (4.1.1-3) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../106-node-d3-dsv_1.1.1-2_all.deb ... Unpacking node-d3-dsv (1.1.1-2) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../107-node-d3-fetch_1.1.2+dfsg-2_all.deb ... Unpacking node-d3-fetch (1.1.2+dfsg-2) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../108-node-d3-quadtree_1.0.7-1_all.deb ... Unpacking node-d3-quadtree (1.0.7-1) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../109-node-d3-force_1.2.1-2_all.deb ... Unpacking node-d3-force (1.2.1-2) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../110-libjs-d3-format_1%3a1.4.1-2_all.deb ... Unpacking libjs-d3-format (1:1.4.1-2) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../111-node-d3-format_1%3a1.4.1-2_all.deb ... Unpacking node-d3-format (1:1.4.1-2) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../112-node-d3-geo_1.11.9-1_all.deb ... Unpacking node-d3-geo (1.11.9-1) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../113-node-d3-hierarchy_1.1.8-2_all.deb ... Unpacking node-d3-hierarchy (1.1.8-2) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../114-node-d3-polygon_1.0.5-2_all.deb ... Unpacking node-d3-polygon (1.0.5-2) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../115-node-d3-random_1.1.2-2_all.deb ... Unpacking node-d3-random (1.1.2-2) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../116-node-d3-time_1.0.11-3_all.deb ... Unpacking node-d3-time (1.0.11-3) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../117-node-d3-time-format_2.1.3-2_all.deb ... Unpacking node-d3-time-format (2.1.3-2) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../118-node-d3-scale_2.2.2-2_all.deb ... Unpacking node-d3-scale (2.2.2-2) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../119-node-d3-scale-chromatic_1.5.0-1_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0-1) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../120-node-d3-shape_1.3.7-1_all.deb ... Unpacking node-d3-shape (1.3.7-1) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../121-node-d3-voronoi_1.1.4-2_all.deb ... Unpacking node-d3-voronoi (1.1.4-2) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../122-node-d3-zoom_1.8.3-1_all.deb ... Unpacking node-d3-zoom (1.8.3-1) ... Selecting previously unselected package node-d3. Preparing to unpack .../123-node-d3_5.16.0-1_all.deb ... Unpacking node-d3 (5.16.0-1) ... Selecting previously unselected package sbuild-build-depends-ataqv-dummy. Preparing to unpack .../124-sbuild-build-depends-ataqv-dummy_0.invalid.0_ppc64el.deb ... Unpacking sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Setting up libboost-chrono1.74.0:ppc64el (1.74.0-3ubuntu1) ... Setting up media-types (1.0.1ubuntu1) ... Setting up libpipeline1:ppc64el (1.5.3-1) ... Setting up libboost-system1.74.0:ppc64el (1.74.0-3ubuntu1) ... Setting up libncurses-dev:ppc64el (6.2+20201114-1) ... Setting up libpsl5:ppc64el (0.21.0-1.1ubuntu1) ... Setting up libboost1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up bsdextrautils (2.36.1-1ubuntu2) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:ppc64el (67.1-5) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libglib2.0-0:ppc64el (2.66.3-2) ... No schema files found: doing nothing. Setting up libboost-iostreams1.74.0:ppc64el (1.74.0-3ubuntu1) ... Setting up libdebhelper-perl (13.3ubuntu1) ... Setting up libbrotli1:ppc64el (1.0.9-2build2) ... Setting up libboost-chrono1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up libnghttp2-14:ppc64el (1.42.0-1) ... Setting up libmagic1:ppc64el (1:5.39-3) ... Setting up libdeflate0:ppc64el (1.6-1) ... Setting up gettext-base (0.19.8.1-10build1) ... Setting up libboost-filesystem1.74.0:ppc64el (1.74.0-3ubuntu1) ... Setting up libc-ares2:ppc64el (1.17.1-1) ... Setting up file (1:5.39-3) ... Setting up libnode72:ppc64el (12.19.0~dfsg-1ubuntu1) ... Setting up libsasl2-modules-db:ppc64el (2.1.27+dfsg-2ubuntu1) ... Setting up autotools-dev (20180224.1) ... Setting up librtmp1:ppc64el (2.4+20151223.gitfa8646d.1-2build2) ... Setting up libboost-system1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up libsigsegv2:ppc64el (2.12-2build1) ... Setting up libboost-regex1.74.0:ppc64el (1.74.0-3ubuntu1) ... Setting up autopoint (0.19.8.1-10build1) ... Setting up icu-devtools (67.1-5) ... Setting up libsasl2-2:ppc64el (2.1.27+dfsg-2ubuntu1) ... Setting up libssh-4:ppc64el (0.9.5-1) ... Setting up libroken18-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up liblzma-dev:ppc64el (5.2.4-1ubuntu1) ... Setting up zlib1g-dev:ppc64el (1:1.2.11.dfsg-2ubuntu4) ... Setting up libjs-d3-format (1:1.4.1-2) ... Setting up libuchardet0:ppc64el (0.0.7-1) ... Setting up libncurses5-dev:ppc64el (6.2+20201114-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libboost-filesystem1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up libdeflate-dev:ppc64el (1.6-1) ... Setting up node-normalize.css (8.0.1-3) ... Setting up mailcap (3.67ubuntu1) ... Setting up libelf1:ppc64el (0.182-1) ... Setting up libicu-dev:ppc64el (67.1-5) ... Setting up libxml2:ppc64el (2.9.10+dfsg-6.3build1) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-2) ... Setting up libboost-filesystem-dev:ppc64el (1.74.0.2ubuntu1) ... Setting up liblocale-gettext-perl (1.07-4build1) ... Setting up node-jquery (3.5.1+dfsg+~3.5.4-3) ... Setting up libpython3.9-stdlib:ppc64el (3.9.1-1) ... Setting up libpython3-stdlib:ppc64el (3.9.0-3ubuntu1) ... Setting up libheimbase1-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up libfile-stripnondeterminism-perl (1.9.0-1) ... Setting up node-iconv:ppc64el (2.3.5-5) ... Setting up mime-support (3.66) ... Setting up libtool (2.4.6-14) ... Setting up libboost-chrono-dev:ppc64el (1.74.0.2ubuntu1) ... Setting up libasn1-8-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up libboost-system-dev:ppc64el (1.74.0.2ubuntu1) ... Setting up m4 (1.4.18-4) ... Setting up nodejs (12.19.0~dfsg-1ubuntu1) ... update-alternatives: using /usr/bin/nodejs to provide /usr/bin/js (js) in auto mode Setting up libhcrypto4-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up node-d3-path (1.0.9-1) ... Setting up help2man (1.47.16) ... Setting up libwind0-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up node-d3-polygon (1.0.5-2) ... Setting up node-d3-quadtree (1.0.7-1) ... Setting up node-d3-collection (1.0.7-2) ... Setting up libcroco3:ppc64el (0.6.13-1) ... Setting up autoconf (2.69-11.1) ... Setting up node-d3-voronoi (1.1.4-2) ... Setting up node-d3-dispatch (1.0.6-1) ... Setting up node-d3-time (1.0.11-3) ... Setting up dh-strip-nondeterminism (1.9.0-1) ... Setting up node-commander (4.1.1-3) ... Setting up dwz (0.13+20201015-2) ... Setting up node-d3-array (1.2.4-2) ... Setting up libboost-regex1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up groff-base (1.22.4-5) ... Setting up libjs-jquery (3.5.1+dfsg+~3.5.4-3) ... Setting up node-d3-geo (1.11.9-1) ... Setting up node-d3-random (1.1.2-2) ... Setting up python3.9 (3.9.1-1) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-4) ... Setting up automake (1:1.16.3-1ubuntu1) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up node-d3-timer (1.0.9-2) ... Setting up node-d3-color (1.2.8-1) ... Setting up node-d3-interpolate (1.4.0-1) ... Setting up node-d3-queue (3.0.7-10) ... Setting up gettext (0.19.8.1-10build1) ... Setting up node-d3-format (1:1.4.1-2) ... Setting up node-d3-hierarchy (1.1.8-2) ... Setting up node-d3-ease (1.0.5-2) ... Setting up node-d3-time-format (2.1.3-2) ... Setting up node-d3-scale-chromatic (1.5.0-1) ... Setting up libhx509-5-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up node-d3-chord (1.0.6-2) ... Setting up node-d3-selection (1.4.0-5) ... Setting up python3 (3.9.0-3ubuntu1) ... Setting up node-d3-axis (1.0.12-2) ... Setting up node-d3-shape (1.3.7-1) ... Setting up man-db (2.9.3-2) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /lib/systemd/system/man-db.timer. Setting up libjs-jquery-datatables (1.10.21+dfsg-1) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up libboost-iostreams1.74-dev:ppc64el (1.74.0-3ubuntu1) ... Setting up node-d3-drag (1.2.5-1) ... Setting up node-rw (1.3.3-2) ... Setting up node-d3-scale (2.2.2-2) ... Setting up node-d3-force (1.2.1-2) ... Setting up node-d3-contour (1.3.2-3) ... Setting up node-d3-dsv (1.1.1-2) ... Setting up node-d3-transition (1.2.0-4) ... Setting up libkrb5-26-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up node-d3-zoom (1.8.3-1) ... Setting up po-debconf (1.0.21) ... Setting up node-d3-fetch (1.1.2+dfsg-2) ... Setting up libboost-iostreams-dev:ppc64el (1.74.0.2ubuntu1) ... Setting up libheimntlm0-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up libgssapi3-heimdal:ppc64el (7.7.0+dfsg-2) ... Setting up node-d3-brush (1.1.5-1) ... Setting up libldap-2.4-2:ppc64el (2.4.53+dfsg-1ubuntu5) ... Setting up libcurl3-gnutls:ppc64el (7.72.0-1ubuntu1) ... Setting up node-d3 (5.16.0-1) ... Setting up libcurl4-gnutls-dev:ppc64el (7.72.0-1ubuntu1) ... Setting up libhts3:ppc64el (1.11-2) ... Setting up libhts-dev:ppc64el (1.11-2) ... Setting up dh-autoreconf (19) ... Setting up debhelper (13.3ubuntu1) ... Setting up sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.32-0ubuntu5) ... +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 4.15.0-128-generic ppc64el (ppc64le) Toolchain package versions: binutils_2.35.50.20201210-0ubuntu2 dpkg-dev_1.20.5ubuntu3 g++-10_10.2.1-1ubuntu1 gcc-10_10.2.1-1ubuntu1 libc6-dev_2.32-0ubuntu5 libstdc++-10-dev_10.2.1-1ubuntu1 libstdc++6_10.2.1-1ubuntu1 linux-libc-dev_5.8.0-32.34+21.04.1 Package versions: adduser_3.118ubuntu4 advancecomp_2.1-2.1build1 apt_2.1.13 autoconf_2.69-11.1 automake_1:1.16.3-1ubuntu1 autopoint_0.19.8.1-10build1 autotools-dev_20180224.1 base-files_11ubuntu16 base-passwd_3.5.48 bash_5.1-1ubuntu1 binutils_2.35.50.20201210-0ubuntu2 binutils-common_2.35.50.20201210-0ubuntu2 binutils-powerpc64le-linux-gnu_2.35.50.20201210-0ubuntu2 bsdextrautils_2.36.1-1ubuntu2 bsdutils_1:2.36.1-1ubuntu2 build-essential_12.8ubuntu3 bzip2_1.0.8-4ubuntu2 ca-certificates_20200601 coreutils_8.32-4ubuntu2 cpp_4:10.2.0-1ubuntu1 cpp-10_10.2.1-1ubuntu1 dash_0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1 debconf_1.5.74 debhelper_13.3ubuntu1 debianutils_4.11.2 dh-autoreconf_19 dh-strip-nondeterminism_1.9.0-1 diffutils_1:3.7-3ubuntu1 dpkg_1.20.5ubuntu3 dpkg-dev_1.20.5ubuntu3 dwz_0.13+20201015-2 e2fsprogs_1.45.6-1ubuntu1 fakeroot_1.25.3-1.1 file_1:5.39-3 findutils_4.7.0-1ubuntu2 fonts-font-awesome_5.0.10+really4.7.0~dfsg-2 g++_4:10.2.0-1ubuntu1 g++-10_10.2.1-1ubuntu1 gcc_4:10.2.0-1ubuntu1 gcc-10_10.2.1-1ubuntu1 gcc-10-base_10.2.1-1ubuntu1 gettext_0.19.8.1-10build1 gettext-base_0.19.8.1-10build1 gpg_2.2.20-1ubuntu1 gpg-agent_2.2.20-1ubuntu1 gpgconf_2.2.20-1ubuntu1 gpgv_2.2.20-1ubuntu1 grep_3.6-1 groff-base_1.22.4-5 gzip_1.10-2ubuntu1 help2man_1.47.16 hostname_3.23 icu-devtools_67.1-5 init_1.59 init-system-helpers_1.59 intltool-debian_0.35.0+20060710.5 libacl1_2.2.53-8 libapparmor1_3.0.0-0ubuntu5 libapt-pkg6.0_2.1.13 libarchive-zip-perl_1.68-1 libargon2-1_0~20171227-0.2build20.10.0 libasan6_10.2.1-1ubuntu1 libasn1-8-heimdal_7.7.0+dfsg-2 libassuan0_2.5.3-7.1 libatomic1_10.2.1-1ubuntu1 libattr1_1:2.4.48-5 libaudit-common_1:2.8.5-3ubuntu3 libaudit1_1:2.8.5-3ubuntu3 libbinutils_2.35.50.20201210-0ubuntu2 libblkid1_2.36.1-1ubuntu2 libboost-chrono-dev_1.74.0.2ubuntu1 libboost-chrono1.74-dev_1.74.0-3ubuntu1 libboost-chrono1.74.0_1.74.0-3ubuntu1 libboost-filesystem-dev_1.74.0.2ubuntu1 libboost-filesystem1.74-dev_1.74.0-3ubuntu1 libboost-filesystem1.74.0_1.74.0-3ubuntu1 libboost-iostreams-dev_1.74.0.2ubuntu1 libboost-iostreams1.74-dev_1.74.0-3ubuntu1 libboost-iostreams1.74.0_1.74.0-3ubuntu1 libboost-regex1.74-dev_1.74.0-3ubuntu1 libboost-regex1.74.0_1.74.0-3ubuntu1 libboost-system-dev_1.74.0.2ubuntu1 libboost-system1.74-dev_1.74.0-3ubuntu1 libboost-system1.74.0_1.74.0-3ubuntu1 libboost1.74-dev_1.74.0-3ubuntu1 libbrotli1_1.0.9-2build2 libbz2-1.0_1.0.8-4ubuntu2 libc-ares2_1.17.1-1 libc-bin_2.32-0ubuntu5 libc-dev-bin_2.32-0ubuntu5 libc6_2.32-0ubuntu5 libc6-dev_2.32-0ubuntu5 libcap-ng0_0.7.9-2.2build1 libcap2_1:2.44-1 libcc1-0_10.2.1-1ubuntu1 libcom-err2_1.45.6-1ubuntu1 libcroco3_0.6.13-1 libcrypt-dev_1:4.4.17-1ubuntu1 libcrypt1_1:4.4.17-1ubuntu1 libcryptsetup12_2:2.3.4-1ubuntu1 libctf-nobfd0_2.35.50.20201210-0ubuntu2 libctf0_2.35.50.20201210-0ubuntu2 libcurl3-gnutls_7.72.0-1ubuntu1 libcurl4-gnutls-dev_7.72.0-1ubuntu1 libdb5.3_5.3.28+dfsg1-0.6ubuntu3 libdebconfclient0_0.255ubuntu1 libdebhelper-perl_13.3ubuntu1 libdeflate-dev_1.6-1 libdeflate0_1.6-1 libdevmapper1.02.1_2:1.02.167-1ubuntu4 libdpkg-perl_1.20.5ubuntu3 libelf1_0.182-1 libexpat1_2.2.10-1 libext2fs2_1.45.6-1ubuntu1 libfakeroot_1.25.3-1.1 libffi8ubuntu1_3.4~20200819gead65ca871-0ubuntu3 libfile-stripnondeterminism-perl_1.9.0-1 libgcc-10-dev_10.2.1-1ubuntu1 libgcc-s1_10.2.1-1ubuntu1 libgcrypt20_1.8.7-2ubuntu1 libgdbm-compat4_1.18.1-5.1 libgdbm6_1.18.1-5.1 libglib2.0-0_2.66.3-2 libgmp10_2:6.2.0+dfsg-6ubuntu1 libgnutls30_3.6.15-4ubuntu2 libgomp1_10.2.1-1ubuntu1 libgpg-error0_1.38-2 libgssapi-krb5-2_1.17-10ubuntu1 libgssapi3-heimdal_7.7.0+dfsg-2 libhcrypto4-heimdal_7.7.0+dfsg-2 libheimbase1-heimdal_7.7.0+dfsg-2 libheimntlm0-heimdal_7.7.0+dfsg-2 libhogweed6_3.6-2 libhts-dev_1.11-2 libhts3_1.11-2 libhx509-5-heimdal_7.7.0+dfsg-2 libicu-dev_67.1-5 libicu67_67.1-5 libidn2-0_2.3.0-4 libip4tc2_1.8.5-3ubuntu4 libisl22_0.22.1-1 libisl23_0.23-1 libitm1_10.2.1-1ubuntu1 libjs-d3-format_1:1.4.1-2 libjs-jquery_3.5.1+dfsg+~3.5.4-3 libjs-jquery-datatables_1.10.21+dfsg-1 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-4 libjson-c5_0.15-1 libk5crypto3_1.17-10ubuntu1 libkeyutils1_1.6.1-2ubuntu1 libkmod2_27+20200310-2ubuntu1 libkrb5-26-heimdal_7.7.0+dfsg-2 libkrb5-3_1.17-10ubuntu1 libkrb5support0_1.17-10ubuntu1 libldap-2.4-2_2.4.53+dfsg-1ubuntu5 liblocale-gettext-perl_1.07-4build1 liblockfile-bin_1.16-1.1 liblockfile1_1.16-1.1 liblsan0_10.2.1-1ubuntu1 liblz4-1_1.9.3-0ubuntu1 liblzma-dev_5.2.4-1ubuntu1 liblzma5_5.2.4-1ubuntu1 libmagic-mgc_1:5.39-3 libmagic1_1:5.39-3 libmount1_2.36.1-1ubuntu2 libmpc3_1.2.0-1 libmpfr6_4.1.0-3 libncurses-dev_6.2+20201114-1 libncurses5-dev_6.2+20201114-1 libncurses6_6.2+20201114-1 libncursesw6_6.2+20201114-1 libnettle8_3.6-2 libnghttp2-14_1.42.0-1 libnode72_12.19.0~dfsg-1ubuntu1 libnpth0_1.6-3 libnsl-dev_1.3.0-0ubuntu3 libnsl2_1.3.0-0ubuntu3 libnss-nis_3.1-0ubuntu4 libnss-nisplus_1.3-0ubuntu4 libp11-kit0_0.23.21-2build1 libpam-modules_1.3.1-5ubuntu6 libpam-modules-bin_1.3.1-5ubuntu6 libpam-runtime_1.3.1-5ubuntu6 libpam0g_1.3.1-5ubuntu6 libpcre2-8-0_10.35-2ubuntu1 libpcre3_2:8.39-13 libperl5.30_5.30.3-4 libperl5.32_5.32.0-5 libpipeline1_1.5.3-1 libpng16-16_1.6.37-3 libprocps8_2:3.3.16-5ubuntu2 libpsl5_0.21.0-1.1ubuntu1 libpython3-stdlib_3.9.0-3ubuntu1 libpython3.9-minimal_3.9.1-1 libpython3.9-stdlib_3.9.1-1 libquadmath0_10.2.1-1ubuntu1 libreadline8_8.1-1 libroken18-heimdal_7.7.0+dfsg-2 librtmp1_2.4+20151223.gitfa8646d.1-2build2 libsasl2-2_2.1.27+dfsg-2ubuntu1 libsasl2-modules-db_2.1.27+dfsg-2ubuntu1 libseccomp2_2.4.3-1ubuntu6 libselinux1_3.1-2build2 libsemanage-common_3.1-1build2 libsemanage1_3.1-1build2 libsepol1_3.1-1 libsigsegv2_2.12-2build1 libsmartcols1_2.36.1-1ubuntu2 libsqlite3-0_3.34.0-1 libss2_1.45.6-1ubuntu1 libssh-4_0.9.5-1 libssl1.1_1.1.1f-1ubuntu5 libstdc++-10-dev_10.2.1-1ubuntu1 libstdc++6_10.2.1-1ubuntu1 libsub-override-perl_0.09-2 libsystemd0_246.6-5ubuntu1 libtasn1-6_4.16.0-2 libtinfo6_6.2+20201114-1 libtirpc-common_1.2.6-3 libtirpc-dev_1.2.6-3 libtirpc3_1.2.6-3 libtool_2.4.6-14 libtsan0_10.2.1-1ubuntu1 libubsan1_10.2.1-1ubuntu1 libuchardet0_0.0.7-1 libudev1_246.6-5ubuntu1 libunistring2_0.9.10-4 libuuid1_2.36.1-1ubuntu2 libwind0-heimdal_7.7.0+dfsg-2 libxml2_2.9.10+dfsg-6.3build1 libzstd1_1.4.5+dfsg-4 linux-libc-dev_5.8.0-32.34+21.04.1 lockfile-progs_0.1.18 login_1:4.8.1-1ubuntu7 logsave_1.45.6-1ubuntu1 lsb-base_11.1.0ubuntu2 m4_1.4.18-4 mailcap_3.67ubuntu1 make_4.3-4ubuntu1 man-db_2.9.3-2 mawk_1.3.4.20200120-2 media-types_1.0.1ubuntu1 mime-support_3.66 mount_2.36.1-1ubuntu2 ncurses-base_6.2+20201114-1 ncurses-bin_6.2+20201114-1 node-commander_4.1.1-3 node-d3_5.16.0-1 node-d3-array_1.2.4-2 node-d3-axis_1.0.12-2 node-d3-brush_1.1.5-1 node-d3-chord_1.0.6-2 node-d3-collection_1.0.7-2 node-d3-color_1.2.8-1 node-d3-contour_1.3.2-3 node-d3-dispatch_1.0.6-1 node-d3-drag_1.2.5-1 node-d3-dsv_1.1.1-2 node-d3-ease_1.0.5-2 node-d3-fetch_1.1.2+dfsg-2 node-d3-force_1.2.1-2 node-d3-format_1:1.4.1-2 node-d3-geo_1.11.9-1 node-d3-hierarchy_1.1.8-2 node-d3-interpolate_1.4.0-1 node-d3-path_1.0.9-1 node-d3-polygon_1.0.5-2 node-d3-quadtree_1.0.7-1 node-d3-queue_3.0.7-10 node-d3-random_1.1.2-2 node-d3-scale_2.2.2-2 node-d3-scale-chromatic_1.5.0-1 node-d3-selection_1.4.0-5 node-d3-shape_1.3.7-1 node-d3-time_1.0.11-3 node-d3-time-format_2.1.3-2 node-d3-timer_1.0.9-2 node-d3-transition_1.2.0-4 node-d3-voronoi_1.1.4-2 node-d3-zoom_1.8.3-1 node-iconv_2.3.5-5 node-jquery_3.5.1+dfsg+~3.5.4-3 node-normalize.css_8.0.1-3 node-rw_1.3.3-2 nodejs_12.19.0~dfsg-1ubuntu1 openssl_1.1.1f-1ubuntu5 optipng_0.7.7-1 passwd_1:4.8.1-1ubuntu7 patch_2.7.6-6 perl_5.32.0-5 perl-base_5.32.0-5 perl-modules-5.30_5.30.3-4 perl-modules-5.32_5.32.0-5 pinentry-curses_1.1.0-4build1 pkgbinarymangler_146 po-debconf_1.0.21 policyrcd-script-zg2_0.1-3 procps_2:3.3.16-5ubuntu2 python3_3.9.0-3ubuntu1 python3-minimal_3.9.0-3ubuntu1 python3.9_3.9.1-1 python3.9-minimal_3.9.1-1 readline-common_8.1-1 rpcsvc-proto_1.4.2-0ubuntu4 sbuild-build-depends-ataqv-dummy_0.invalid.0 sbuild-build-depends-core-dummy_0.invalid.0 sed_4.7-1ubuntu1 sensible-utils_0.0.13 systemd_246.6-5ubuntu1 systemd-sysv_246.6-5ubuntu1 systemd-timesyncd_246.6-5ubuntu1 sysvinit-utils_2.96-5ubuntu1 tar_1.32+dfsg-1 tzdata_2020d-1ubuntu1 ubuntu-keyring_2020.06.17.1 util-linux_2.36.1-1ubuntu2 xz-utils_5.2.4-1ubuntu1 zlib1g_1:1.2.11.dfsg-2ubuntu4 zlib1g-dev_1:1.2.11.dfsg-2ubuntu4 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- gpgv: Signature made Sat Dec 12 12:17:40 2020 UTC gpgv: using RSA key D56571B88A8BBAF140BF63D6BD7EAA60778FA6F5 gpgv: issuer "doko@ubuntu.com" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./ataqv_1.2.1+ds-1build1.dsc dpkg-source: info: extracting ataqv in /<>/ataqv-1.2.1+ds dpkg-source: info: unpacking ataqv_1.2.1+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.2.1+ds-1build1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-20400304 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-20400304 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-20400304 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.2.1+ds-1build1 dpkg-buildpackage: info: source distribution hirsute dpkg-source --before-build . dpkg-buildpackage: info: host architecture ppc64el debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_clean debian/rules binary-arch dh binary-arch dh_update_autotools_config -a dh_autoreconf -a debian/rules override_dh_auto_configure make[1]: Entering directory '/<>/ataqv-1.2.1+ds' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' debian/rules override_dh_auto_build make[1]: Entering directory '/<>/ataqv-1.2.1+ds' dh_auto_build -- all testing/run_ataqv_tests make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/<>/ataqv-1.2.1+ds' g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/ataqv.o -c /<>/ataqv-1.2.1+ds/src/cpp/ataqv.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp In file included from /usr/include/boost/smart_ptr/detail/shared_count.hpp:31, from /usr/include/boost/smart_ptr/shared_ptr.hpp:17, from /usr/include/boost/shared_ptr.hpp:17, from /usr/include/boost/iostreams/device/file.hpp:24, from /<>/ataqv-1.2.1+ds/src/cpp/IO.hpp:8, from /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp:3: /usr/include/boost/throw_exception.hpp: In member function ‘void boost::wrapexcept::rethrow() const [with E = boost::iostreams::gzip_error]’: /usr/include/boost/throw_exception.hpp:154:18: note: the layout of aggregates containing vectors with 8-byte alignment has changed in GCC 5 154 | virtual void rethrow() const BOOST_OVERRIDE | ^~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /<>/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_features.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_hts.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_io.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_io.cpp In file included from /usr/include/c++/10/bits/shared_ptr.h:52, from /usr/include/c++/10/memory:84, from /usr/include/c++/10/thread:44, from /usr/include/c++/10/future:39, from /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:10: /usr/include/c++/10/bits/shared_ptr_base.h: In member function ‘void MetricsCollector::calculate_tss_coverage()’: /usr/include/c++/10/bits/shared_ptr_base.h:763:8: note: the layout of aggregates containing vectors with 8-byte alignment has changed in GCC 5 763 | _M_pi = __tmp; | ~~~~~~^~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:172:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 172 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:177:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 177 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____242()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:248:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 248 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____251()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:258:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 258 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_utils.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp:2: /<>/ataqv-1.2.1+ds/src/cpp/catch.hpp: In constructor ‘Catch::Config::Config(const Catch::ConfigData&)’: /<>/ataqv-1.2.1+ds/src/cpp/catch.hpp:3546:9: note: the layout of aggregates containing vectors with 8-byte alignment has changed in GCC 5 3546 | Config( ConfigData const& data ) | ^~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp In file included from /usr/include/boost/smart_ptr/detail/shared_count.hpp:31, from /usr/include/boost/smart_ptr/shared_ptr.hpp:17, from /usr/include/boost/shared_ptr.hpp:17, from /usr/include/boost/iostreams/device/file.hpp:24, from /<>/ataqv-1.2.1+ds/src/cpp/IO.hpp:8, from /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp:3: /usr/include/boost/throw_exception.hpp: In member function ‘void boost::wrapexcept::rethrow() const [with E = boost::iostreams::gzip_error]’: /usr/include/boost/throw_exception.hpp:154:18: note: the layout of aggregates containing vectors with 8-byte alignment has changed in GCC 5 154 | virtual void rethrow() const BOOST_OVERRIDE | ^~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In file included from /usr/include/c++/10/bits/shared_ptr.h:52, from /usr/include/c++/10/memory:84, from /usr/include/c++/10/thread:44, from /usr/include/c++/10/future:39, from /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:10: /usr/include/c++/10/bits/shared_ptr_base.h: In member function ‘void MetricsCollector::calculate_tss_coverage()’: /usr/include/c++/10/bits/shared_ptr_base.h:763:8: note: the layout of aggregates containing vectors with 8-byte alignment has changed in GCC 5 763 | _M_pi = __tmp; | ~~~~~~^~~~~~~ g++ -g -O3 -fdebug-prefix-map=/<>/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_auto_test -a make -j4 test make[1]: Entering directory '/<>/ataqv-1.2.1+ds' [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 3.08289 seconds. (8105.69 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 21.9254 seconds. (1700.13 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 22.0309 seconds. (1691.99 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 21.853 seconds. (1705.757 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. =============================================================================== All tests passed (241 assertions in 54 test cases) make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' create-stamp debian/debhelper-build-stamp dh_prep -a debian/rules override_dh_auto_install make[1]: Entering directory '/<>/ataqv-1.2.1+ds' dh_auto_install -- prefix=/usr make -j4 install DESTDIR=/<>/ataqv-1.2.1\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr make[2]: Entering directory '/<>/ataqv-1.2.1+ds' Installing to /usr install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.2.1/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin; done install -m 0755 build/ataqv /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin cp -a src/web/* /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web find /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; make[2]: Leaving directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_install -a dh_installdocs -a dh_installchangelogs -a dh_installexamples -a debian/rules override_dh_installman make[1]: Entering directory '/<>/ataqv-1.2.1+ds' help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.2.1+ds src/scripts/srvarv > debian/srvarv.1 dh_installman make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_perl -a dh_link -a dh_strip_nondeterminism -a dh_compress -a dh_fixperms -a dh_missing -a dh_dwz -a -a dh_strip -a -a dh_makeshlibs -a -a dh_shlibdeps -a -a dh_installdeb -a dh_gencontrol -a dh_md5sums -a dh_builddeb -a INFO: pkgstriptranslations version 146 INFO: pkgstriptranslations version 146 pkgstriptranslations: processing ataqv (in debian/ataqv); do_strip: , oemstrip: pkgstriptranslations: processing ataqv-dbgsym (in debian/.debhelper/ataqv/dbgsym-root); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/ataqv/DEBIAN/control, package ataqv, directory debian/ataqv pkgstripfiles: Running PNG optimization (using 4 cpus) for package ataqv ... pkgstripfiles: No PNG files. dpkg-deb: building package 'ataqv' in '../ataqv_1.2.1+ds-1build1_ppc64el.deb'. pkgstripfiles: processing control file: debian/.debhelper/ataqv/dbgsym-root/DEBIAN/control, package ataqv-dbgsym, directory debian/.debhelper/ataqv/dbgsym-root dpkg-deb: building package 'ataqv-dbgsym' in 'debian/.debhelper/scratch-space/build-ataqv/ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.deb'. Renaming ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.deb to ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb dpkg-genbuildinfo --build=any dpkg-genchanges --build=any -mLaunchpad Build Daemon >../ataqv_1.2.1+ds-1build1_ppc64el.changes dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) -------------------------------------------------------------------------------- Build finished at 2020-12-12T12:38:04Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Post Build Chroot | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ ataqv_1.2.1+ds-1build1_ppc64el.changes: --------------------------------------- Format: 1.8 Date: Sat, 12 Dec 2020 13:03:13 +0100 Source: ataqv Binary: ataqv Architecture: ppc64el Version: 1.2.1+ds-1build1 Distribution: hirsute-proposed Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Matthias Klose Description: ataqv - ATAC-seq QC and visualization Changes: ataqv (1.2.1+ds-1build1) hirsute; urgency=medium . * No-change rebuild for boost soname change. Checksums-Sha1: 020054acb50cdcfe56c0930c644009e15db1fa14 8320804 ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb 5ab8b7bbcea85f6839d9cf22cd2f6639ebb7ca70 9615 ataqv_1.2.1+ds-1build1_ppc64el.buildinfo 935674e3cc0ffefde9530e75e11088f98226d92f 3382016 ataqv_1.2.1+ds-1build1_ppc64el.deb Checksums-Sha256: e6673e73c2638c2a3ca74202cf6a016e0b11f7e9bbcf53dd7b9b613f9d9b0b43 8320804 ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb 9a5a99478c1c62abc4e9b74ad70c5b65003284d912ea74b41c28f34b25964eed 9615 ataqv_1.2.1+ds-1build1_ppc64el.buildinfo ef381c2ec1bdd47089322f72479f83c0a072cdad3ba1a6a4d8c7c980e186b77f 3382016 ataqv_1.2.1+ds-1build1_ppc64el.deb Files: 683f2c2ba77532c06515e16e19d953f6 8320804 debug optional ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb 2a75bb5fba4f0705c48da99434afed69 9615 science optional ataqv_1.2.1+ds-1build1_ppc64el.buildinfo 90c75741bb799c6e21dfaae47833ec7b 3382016 science optional ataqv_1.2.1+ds-1build1_ppc64el.deb +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: ataqv Binary: ataqv ataqv-dbgsym Architecture: ppc64el Version: 1.2.1+ds-1build1 Checksums-Md5: 683f2c2ba77532c06515e16e19d953f6 8320804 ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb 90c75741bb799c6e21dfaae47833ec7b 3382016 ataqv_1.2.1+ds-1build1_ppc64el.deb Checksums-Sha1: 020054acb50cdcfe56c0930c644009e15db1fa14 8320804 ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb 935674e3cc0ffefde9530e75e11088f98226d92f 3382016 ataqv_1.2.1+ds-1build1_ppc64el.deb Checksums-Sha256: e6673e73c2638c2a3ca74202cf6a016e0b11f7e9bbcf53dd7b9b613f9d9b0b43 8320804 ataqv-dbgsym_1.2.1+ds-1build1_ppc64el.ddeb ef381c2ec1bdd47089322f72479f83c0a072cdad3ba1a6a4d8c7c980e186b77f 3382016 ataqv_1.2.1+ds-1build1_ppc64el.deb Build-Origin: Ubuntu Build-Architecture: ppc64el Build-Date: Sat, 12 Dec 2020 12:38:03 +0000 Build-Path: /<>/ataqv-1.2.1+ds Build-Tainted-By: usr-local-has-programs Installed-Build-Depends: autoconf (= 2.69-11.1), automake (= 1:1.16.3-1ubuntu1), autopoint (= 0.19.8.1-10build1), autotools-dev (= 20180224.1), base-files (= 11ubuntu16), base-passwd (= 3.5.48), bash (= 5.1-1ubuntu1), binutils (= 2.35.50.20201210-0ubuntu2), binutils-common (= 2.35.50.20201210-0ubuntu2), binutils-powerpc64le-linux-gnu (= 2.35.50.20201210-0ubuntu2), bsdextrautils (= 2.36.1-1ubuntu2), bsdutils (= 1:2.36.1-1ubuntu2), build-essential (= 12.8ubuntu3), bzip2 (= 1.0.8-4ubuntu2), coreutils (= 8.32-4ubuntu2), cpp (= 4:10.2.0-1ubuntu1), cpp-10 (= 10.2.1-1ubuntu1), dash (= 0.5.11+git20200708+dd9ef66+really0.5.10.2-0ubuntu1), debconf (= 1.5.74), debhelper (= 13.3ubuntu1), debianutils (= 4.11.2), dh-autoreconf (= 19), dh-strip-nondeterminism (= 1.9.0-1), diffutils (= 1:3.7-3ubuntu1), dpkg (= 1.20.5ubuntu3), dpkg-dev (= 1.20.5ubuntu3), dwz (= 0.13+20201015-2), file (= 1:5.39-3), findutils (= 4.7.0-1ubuntu2), fonts-font-awesome (= 5.0.10+really4.7.0~dfsg-2), g++ (= 4:10.2.0-1ubuntu1), g++-10 (= 10.2.1-1ubuntu1), gcc (= 4:10.2.0-1ubuntu1), gcc-10 (= 10.2.1-1ubuntu1), gcc-10-base (= 10.2.1-1ubuntu1), gettext (= 0.19.8.1-10build1), gettext-base (= 0.19.8.1-10build1), grep (= 3.6-1), groff-base (= 1.22.4-5), gzip (= 1.10-2ubuntu1), help2man (= 1.47.16), hostname (= 3.23), icu-devtools (= 67.1-5), init-system-helpers (= 1.59), intltool-debian (= 0.35.0+20060710.5), libacl1 (= 2.2.53-8), libarchive-zip-perl (= 1.68-1), libasan6 (= 10.2.1-1ubuntu1), libasn1-8-heimdal (= 7.7.0+dfsg-2), libatomic1 (= 10.2.1-1ubuntu1), libattr1 (= 1:2.4.48-5), libaudit-common (= 1:2.8.5-3ubuntu3), libaudit1 (= 1:2.8.5-3ubuntu3), libbinutils (= 2.35.50.20201210-0ubuntu2), libblkid1 (= 2.36.1-1ubuntu2), libboost-chrono-dev (= 1.74.0.2ubuntu1), libboost-chrono1.74-dev (= 1.74.0-3ubuntu1), libboost-chrono1.74.0 (= 1.74.0-3ubuntu1), libboost-filesystem-dev (= 1.74.0.2ubuntu1), libboost-filesystem1.74-dev (= 1.74.0-3ubuntu1), libboost-filesystem1.74.0 (= 1.74.0-3ubuntu1), libboost-iostreams-dev (= 1.74.0.2ubuntu1), libboost-iostreams1.74-dev (= 1.74.0-3ubuntu1), libboost-iostreams1.74.0 (= 1.74.0-3ubuntu1), libboost-regex1.74-dev (= 1.74.0-3ubuntu1), libboost-regex1.74.0 (= 1.74.0-3ubuntu1), libboost-system-dev (= 1.74.0.2ubuntu1), libboost-system1.74-dev (= 1.74.0-3ubuntu1), libboost-system1.74.0 (= 1.74.0-3ubuntu1), libboost1.74-dev (= 1.74.0-3ubuntu1), libbrotli1 (= 1.0.9-2build2), libbz2-1.0 (= 1.0.8-4ubuntu2), libc-ares2 (= 1.17.1-1), libc-bin (= 2.32-0ubuntu5), libc-dev-bin (= 2.32-0ubuntu5), libc6 (= 2.32-0ubuntu5), libc6-dev (= 2.32-0ubuntu5), libcap-ng0 (= 0.7.9-2.2build1), libcc1-0 (= 10.2.1-1ubuntu1), libcom-err2 (= 1.45.6-1ubuntu1), libcroco3 (= 0.6.13-1), libcrypt-dev (= 1:4.4.17-1ubuntu1), libcrypt1 (= 1:4.4.17-1ubuntu1), libctf-nobfd0 (= 2.35.50.20201210-0ubuntu2), libctf0 (= 2.35.50.20201210-0ubuntu2), libcurl3-gnutls (= 7.72.0-1ubuntu1), libcurl4-gnutls-dev (= 7.72.0-1ubuntu1), libdb5.3 (= 5.3.28+dfsg1-0.6ubuntu3), libdebconfclient0 (= 0.255ubuntu1), libdebhelper-perl (= 13.3ubuntu1), libdeflate-dev (= 1.6-1), libdeflate0 (= 1.6-1), libdpkg-perl (= 1.20.5ubuntu3), libelf1 (= 0.182-1), libexpat1 (= 2.2.10-1), libffi8ubuntu1 (= 3.4~20200819gead65ca871-0ubuntu3), libfile-stripnondeterminism-perl (= 1.9.0-1), libgcc-10-dev (= 10.2.1-1ubuntu1), libgcc-s1 (= 10.2.1-1ubuntu1), libgcrypt20 (= 1.8.7-2ubuntu1), libgdbm-compat4 (= 1.18.1-5.1), libgdbm6 (= 1.18.1-5.1), libglib2.0-0 (= 2.66.3-2), libgmp10 (= 2:6.2.0+dfsg-6ubuntu1), libgnutls30 (= 3.6.15-4ubuntu2), libgomp1 (= 10.2.1-1ubuntu1), libgpg-error0 (= 1.38-2), libgssapi-krb5-2 (= 1.17-10ubuntu1), libgssapi3-heimdal (= 7.7.0+dfsg-2), libhcrypto4-heimdal (= 7.7.0+dfsg-2), libheimbase1-heimdal (= 7.7.0+dfsg-2), libheimntlm0-heimdal (= 7.7.0+dfsg-2), libhogweed6 (= 3.6-2), libhts-dev (= 1.11-2), libhts3 (= 1.11-2), libhx509-5-heimdal (= 7.7.0+dfsg-2), libicu-dev (= 67.1-5), libicu67 (= 67.1-5), libidn2-0 (= 2.3.0-4), libisl23 (= 0.23-1), libitm1 (= 10.2.1-1ubuntu1), libjs-d3-format (= 1:1.4.1-2), libjs-jquery (= 3.5.1+dfsg+~3.5.4-3), libjs-jquery-datatables (= 1.10.21+dfsg-1), libjs-jquery-datatables-extensions (= 0.0+git20150910.28fd64e+dfsg-4), libk5crypto3 (= 1.17-10ubuntu1), libkeyutils1 (= 1.6.1-2ubuntu1), libkrb5-26-heimdal (= 7.7.0+dfsg-2), libkrb5-3 (= 1.17-10ubuntu1), libkrb5support0 (= 1.17-10ubuntu1), libldap-2.4-2 (= 2.4.53+dfsg-1ubuntu5), liblocale-gettext-perl (= 1.07-4build1), liblsan0 (= 10.2.1-1ubuntu1), liblz4-1 (= 1.9.3-0ubuntu1), liblzma-dev (= 5.2.4-1ubuntu1), liblzma5 (= 5.2.4-1ubuntu1), libmagic-mgc (= 1:5.39-3), libmagic1 (= 1:5.39-3), libmount1 (= 2.36.1-1ubuntu2), libmpc3 (= 1.2.0-1), libmpfr6 (= 4.1.0-3), libncurses-dev (= 6.2+20201114-1), libncurses5-dev (= 6.2+20201114-1), libncurses6 (= 6.2+20201114-1), libncursesw6 (= 6.2+20201114-1), libnettle8 (= 3.6-2), libnghttp2-14 (= 1.42.0-1), libnode72 (= 12.19.0~dfsg-1ubuntu1), libnsl-dev (= 1.3.0-0ubuntu3), libnsl2 (= 1.3.0-0ubuntu3), libp11-kit0 (= 0.23.21-2build1), libpam-modules (= 1.3.1-5ubuntu6), libpam-modules-bin (= 1.3.1-5ubuntu6), libpam-runtime (= 1.3.1-5ubuntu6), libpam0g (= 1.3.1-5ubuntu6), libpcre2-8-0 (= 10.35-2ubuntu1), libpcre3 (= 2:8.39-13), libperl5.32 (= 5.32.0-5), libpipeline1 (= 1.5.3-1), libpsl5 (= 0.21.0-1.1ubuntu1), libpython3-stdlib (= 3.9.0-3ubuntu1), libpython3.9-minimal (= 3.9.1-1), libpython3.9-stdlib (= 3.9.1-1), libquadmath0 (= 10.2.1-1ubuntu1), libreadline8 (= 8.1-1), libroken18-heimdal (= 7.7.0+dfsg-2), librtmp1 (= 2.4+20151223.gitfa8646d.1-2build2), libsasl2-2 (= 2.1.27+dfsg-2ubuntu1), libsasl2-modules-db (= 2.1.27+dfsg-2ubuntu1), libseccomp2 (= 2.4.3-1ubuntu6), libselinux1 (= 3.1-2build2), libsigsegv2 (= 2.12-2build1), libsmartcols1 (= 2.36.1-1ubuntu2), libsqlite3-0 (= 3.34.0-1), libssh-4 (= 0.9.5-1), libssl1.1 (= 1.1.1f-1ubuntu5), libstdc++-10-dev (= 10.2.1-1ubuntu1), libstdc++6 (= 10.2.1-1ubuntu1), libsub-override-perl (= 0.09-2), libsystemd0 (= 246.6-5ubuntu1), libtasn1-6 (= 4.16.0-2), libtinfo6 (= 6.2+20201114-1), libtirpc-common (= 1.2.6-3), libtirpc-dev (= 1.2.6-3), libtirpc3 (= 1.2.6-3), libtool (= 2.4.6-14), libtsan0 (= 10.2.1-1ubuntu1), libubsan1 (= 10.2.1-1ubuntu1), libuchardet0 (= 0.0.7-1), libudev1 (= 246.6-5ubuntu1), libunistring2 (= 0.9.10-4), libuuid1 (= 2.36.1-1ubuntu2), libwind0-heimdal (= 7.7.0+dfsg-2), libxml2 (= 2.9.10+dfsg-6.3build1), libzstd1 (= 1.4.5+dfsg-4), linux-libc-dev (= 5.8.0-32.34+21.04.1), login (= 1:4.8.1-1ubuntu7), lsb-base (= 11.1.0ubuntu2), m4 (= 1.4.18-4), mailcap (= 3.67ubuntu1), make (= 4.3-4ubuntu1), man-db (= 2.9.3-2), mawk (= 1.3.4.20200120-2), media-types (= 1.0.1ubuntu1), mime-support (= 3.66), ncurses-base (= 6.2+20201114-1), ncurses-bin (= 6.2+20201114-1), node-commander (= 4.1.1-3), node-d3 (= 5.16.0-1), node-d3-array (= 1.2.4-2), node-d3-axis (= 1.0.12-2), node-d3-brush (= 1.1.5-1), node-d3-chord (= 1.0.6-2), node-d3-collection (= 1.0.7-2), node-d3-color (= 1.2.8-1), node-d3-contour (= 1.3.2-3), node-d3-dispatch (= 1.0.6-1), node-d3-drag (= 1.2.5-1), node-d3-dsv (= 1.1.1-2), node-d3-ease (= 1.0.5-2), node-d3-fetch (= 1.1.2+dfsg-2), node-d3-force (= 1.2.1-2), node-d3-format (= 1:1.4.1-2), node-d3-geo (= 1.11.9-1), node-d3-hierarchy (= 1.1.8-2), node-d3-interpolate (= 1.4.0-1), node-d3-path (= 1.0.9-1), node-d3-polygon (= 1.0.5-2), node-d3-quadtree (= 1.0.7-1), node-d3-queue (= 3.0.7-10), node-d3-random (= 1.1.2-2), node-d3-scale (= 2.2.2-2), node-d3-scale-chromatic (= 1.5.0-1), node-d3-selection (= 1.4.0-5), node-d3-shape (= 1.3.7-1), node-d3-time (= 1.0.11-3), node-d3-time-format (= 2.1.3-2), node-d3-timer (= 1.0.9-2), node-d3-transition (= 1.2.0-4), node-d3-voronoi (= 1.1.4-2), node-d3-zoom (= 1.8.3-1), node-iconv (= 2.3.5-5), node-jquery (= 3.5.1+dfsg+~3.5.4-3), node-normalize.css (= 8.0.1-3), node-rw (= 1.3.3-2), nodejs (= 12.19.0~dfsg-1ubuntu1), patch (= 2.7.6-6), perl (= 5.32.0-5), perl-base (= 5.32.0-5), perl-modules-5.32 (= 5.32.0-5), po-debconf (= 1.0.21), python3 (= 3.9.0-3ubuntu1), python3-minimal (= 3.9.0-3ubuntu1), python3.9 (= 3.9.1-1), python3.9-minimal (= 3.9.1-1), readline-common (= 8.1-1), rpcsvc-proto (= 1.4.2-0ubuntu4), sed (= 4.7-1ubuntu1), sensible-utils (= 0.0.13), sysvinit-utils (= 2.96-5ubuntu1), tar (= 1.32+dfsg-1), tzdata (= 2020d-1ubuntu1), util-linux (= 2.36.1-1ubuntu2), xz-utils (= 5.2.4-1ubuntu1), zlib1g (= 1:1.2.11.dfsg-2ubuntu4), zlib1g-dev (= 1:1.2.11.dfsg-2ubuntu4) Environment: DEB_BUILD_OPTIONS="parallel=4" LANG="C.UTF-8" LC_ALL="C.UTF-8" SOURCE_DATE_EPOCH="1607774593" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ ataqv_1.2.1+ds-1build1_ppc64el.deb ---------------------------------- new Debian package, version 2.0. size 3382016 bytes: control archive=1816 bytes. 1051 bytes, 17 lines control 2422 bytes, 32 lines md5sums Package: ataqv Version: 1.2.1+ds-1build1 Architecture: ppc64el Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 6847 Depends: libboost-chrono1.74.0 (>= 1.74.0), libboost-filesystem1.74.0 (>= 1.74.0), libboost-iostreams1.74.0 (>= 1.74.0), libc6 (>= 2.22), libgcc-s1 (>= 4.2), libhts3 (>= 1.10), libncurses6 (>= 6), libstdc++6 (>= 9), libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, python3, node-d3 Suggests: picard-tools, samtools, macs, wget Section: science Priority: optional Homepage: https://github.com/ParkerLab/ataqv/ Description: ATAC-seq QC and visualization A toolkit for measuring and comparing ATAC-seq results, made in the Parker lab at the University of Michigan. They wrote it to help understand how well their ATAC-seq assays had worked, and to make it easier to spot differences that might be caused by library prep or sequencing. drwxr-xr-x root/root 0 2020-12-12 12:03 ./ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/bin/ -rwxr-xr-x root/root 658408 2020-12-12 12:03 ./usr/bin/ataqv -rwxr-xr-x root/root 3020 2020-12-12 12:03 ./usr/bin/make_ataqv_pipeline -rwxr-xr-x root/root 36049 2020-12-12 12:03 ./usr/bin/mkarv -rwxr-xr-x root/root 1634 2020-12-12 12:03 ./usr/bin/run_ataqv_example -rwxr-xr-x root/root 1142 2020-12-12 12:03 ./usr/bin/srvarv drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/lib/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/lib/ataqv/ -rwxr-xr-x root/root 1378848 2020-12-12 12:03 ./usr/lib/ataqv/run_ataqv_tests drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/ -rw-r--r-- root/root 18865 2020-07-08 15:43 ./usr/share/ataqv/web/css/ataqv.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/datatables.buttons.min.css -> ../../../javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css -rw-r--r-- root/root 3362 2020-07-08 15:43 ./usr/share/ataqv/web/css/datatables.fontawesome.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/datatables.min.css -> ../../../javascript/jquery-datatables/css/jquery.dataTables.min.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/font-awesome.min.css -> ../../../fonts-font-awesome/css/font-awesome.min.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/normalize.css -> ../../../javascript/normalize.css/normalize.css drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/ lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/FontAwesome.otf -> ../../../fonts-font-awesome/fonts/FontAwesome.otf lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.eot -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.eot lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.svg -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.svg lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.ttf -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.ttf lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff2 -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff2 -rw-r--r-- root/root 34052 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-regular.woff -rw-r--r-- root/root 28724 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-regularit.woff -rw-r--r-- root/root 33848 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-semibold.woff -rw-r--r-- root/root 28624 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-semiboldit.woff -rw-r--r-- root/root 51122 2020-12-12 12:03 ./usr/share/ataqv/web/index.html drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/ -rw-r--r-- root/root 69250 2020-07-08 15:43 ./usr/share/ataqv/web/js/ataqv.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.colVis.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.html5.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.print.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/d3.min.js -> ../../../nodejs/d3/dist/d3.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/dataTables.buttons.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/dataTables.responsive.min.js -> ../../../javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jquery.dataTables.min.js -> ../../../javascript/jquery-datatables/jquery.dataTables.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jquery.min.js -> ../../../javascript/jquery/jquery.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jszip.min.js -> ../../../javascript/jquery-datatables-extensions/JSZip/jszip.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/pdfmake.min.js -> ../../../javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/ -rw-r--r-- root/root 5178 2020-07-08 15:43 ./usr/share/doc/ataqv/README.rst.gz -rw-r--r-- root/root 565 2020-12-12 12:03 ./usr/share/doc/ataqv/changelog.Debian.gz -rw-r--r-- root/root 8547 2020-10-01 11:29 ./usr/share/doc/ataqv/copyright drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/ -rw-r--r-- root/root 37149 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam -rw-r--r-- root/root 773256 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam.bai -rw-r--r-- root/root 418285 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/SRR891275.peaks.gz -rw-r--r-- root/root 37198 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891278.bam -rw-r--r-- root/root 952573 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/SRR891278.peaks.gz -rw-r--r-- root/root 4708 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/exclude.dac.bed.gz -rw-r--r-- root/root 17130 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/exclude.duke.bed.gz -rw-r--r-- root/root 288924 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/hg19.tss.refseq.bed.gz -rwxr-xr-x root/root 2617 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/mktd.sh -rw-r--r-- root/root 72177 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/test.bam -rw-r--r-- root/root 1017208 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/test.bam.bai -rw-r--r-- root/root 968461 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/test.peaks.gz drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/man/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/man/man1/ -rw-r--r-- root/root 2009 2020-12-12 12:03 ./usr/share/man/man1/ataqv.1.gz -rw-r--r-- root/root 1630 2020-12-12 12:03 ./usr/share/man/man1/mkarv.1.gz -rw-r--r-- root/root 382 2020-12-12 12:03 ./usr/share/man/man1/srvarv.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: ppc64el Build Type: any Build-Space: n/a Build-Time: 151 Distribution: hirsute-proposed Host Architecture: ppc64el Install-Time: 35 Job: ataqv_1.2.1+ds-1build1.dsc Machine Architecture: ppc64el Package: ataqv Package-Time: 188 Source-Version: 1.2.1+ds-1build1 Space: n/a Status: successful Version: 1.2.1+ds-1build1 -------------------------------------------------------------------------------- Finished at 2020-12-12T12:38:04Z Build needed 00:03:08, no disk space RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=hirsute --arch=ppc64el PACKAGEBUILD-20400304 Scanning for processes to kill in build PACKAGEBUILD-20400304